Incidental Mutation 'R6456:Olfr418'
ID520142
Institutional Source Beutler Lab
Gene Symbol Olfr418
Ensembl Gene ENSMUSG00000049605
Gene Nameolfactory receptor 418
SynonymsGA_x6K02T2P20D-20826777-20827719, MOR267-8, GA_x6K02T2R7CC-581296-580364, Olfr418-ps1, Olfr1403, MOR267-12P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location173266001-173273994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 173270538 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 121 (D121V)
Ref Sequence ENSEMBL: ENSMUSP00000150427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059754] [ENSMUST00000111224] [ENSMUST00000213420]
Predicted Effect probably damaging
Transcript: ENSMUST00000059754
AA Change: D121V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052418
Gene: ENSMUSG00000049605
AA Change: D121V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.6e-55 PFAM
Pfam:7tm_1 41 289 5.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111224
SMART Domains Protein: ENSMUSP00000106855
Gene: ENSMUSG00000079180

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PTX 20 219 1.93e-94 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000213420
AA Change: D121V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Olfr418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01418:Olfr418 APN 1 173270708 missense probably damaging 1.00
IGL01930:Olfr418 APN 1 173270610 missense probably benign
IGL01963:Olfr418 APN 1 173270352 missense probably damaging 0.99
IGL02104:Olfr418 APN 1 173271036 missense probably damaging 0.96
IGL02192:Olfr418 APN 1 173270850 missense probably damaging 1.00
IGL02256:Olfr418 APN 1 173270627 missense probably benign 0.04
IGL02340:Olfr418 APN 1 173270405 missense probably benign 0.10
IGL02454:Olfr418 APN 1 173270940 missense probably damaging 0.99
IGL02638:Olfr418 APN 1 173270331 missense probably benign 0.07
FR4737:Olfr418 UTSW 1 173270630 frame shift probably null
FR4976:Olfr418 UTSW 1 173270630 frame shift probably null
R0552:Olfr418 UTSW 1 173270805 missense probably benign 0.05
R0621:Olfr418 UTSW 1 173270675 missense possibly damaging 0.48
R0735:Olfr418 UTSW 1 173271002 missense probably benign 0.05
R1506:Olfr418 UTSW 1 173270769 missense probably benign 0.04
R1670:Olfr418 UTSW 1 173270900 missense probably damaging 1.00
R2111:Olfr418 UTSW 1 173270312 missense probably benign
R2204:Olfr418 UTSW 1 173270136 unclassified probably null
R4475:Olfr418 UTSW 1 173270913 missense probably damaging 0.99
R4909:Olfr418 UTSW 1 173270979 missense probably damaging 0.97
R5457:Olfr418 UTSW 1 173270574 missense probably benign 0.00
R6124:Olfr418 UTSW 1 173270279 missense probably damaging 1.00
R7220:Olfr418 UTSW 1 173270244 missense possibly damaging 0.56
R7240:Olfr418 UTSW 1 173270994 missense probably benign 0.27
R7672:Olfr418 UTSW 1 173270873 missense probably benign 0.18
R8073:Olfr418 UTSW 1 173270985 missense probably benign 0.42
RF032:Olfr418 UTSW 1 173270709 frame shift probably null
RF036:Olfr418 UTSW 1 173270709 frame shift probably null
RF040:Olfr418 UTSW 1 173270709 frame shift probably null
X0019:Olfr418 UTSW 1 173270557 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGGTATTGATCGTCACCTTCATAC -3'
(R):5'- TCATAACTGGGCGGATGTCAC -3'

Sequencing Primer
(F):5'- GATCGTCACCTTCATACTCCCATG -3'
(R):5'- GTCACAGAAATAGTGGGCTACTTCTC -3'
Posted On2018-06-06