Incidental Mutation 'R6456:Anapc2'
ID520145
Institutional Source Beutler Lab
Gene Symbol Anapc2
Ensembl Gene ENSMUSG00000026965
Gene Nameanaphase promoting complex subunit 2
SynonymsEmi4, 9230107K09Rik, Imi4, expressed during mesenchymal induction 4, APC2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25272478-25285915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25280195 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 575 (M575T)
Ref Sequence ENSEMBL: ENSMUSP00000028341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028341] [ENSMUST00000129300]
Predicted Effect probably damaging
Transcript: ENSMUST00000028341
AA Change: M575T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028341
Gene: ENSMUSG00000026965
AA Change: M575T

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 221 229 N/A INTRINSIC
low complexity region 456 467 N/A INTRINSIC
CULLIN 515 663 6.72e-9 SMART
APC2 772 832 3.67e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129265
Predicted Effect probably benign
Transcript: ENSMUST00000129300
SMART Domains Protein: ENSMUSP00000115177
Gene: ENSMUSG00000026965

DomainStartEndE-ValueType
low complexity region 170 181 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle by ubiquitinating its specific substrates, such as mitotic cyclins and anaphase inhibitor, for subsequent degradation by the proteasome. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before E6.5. Conditional ablation in the liver results in liver failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Anapc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Anapc2 APN 2 25274782 missense possibly damaging 0.65
IGL01575:Anapc2 APN 2 25285176 splice site probably benign
IGL01993:Anapc2 APN 2 25274713 missense probably benign 0.00
IGL02586:Anapc2 APN 2 25285096 missense probably benign 0.08
IGL02721:Anapc2 APN 2 25274668 nonsense probably null
FR4976:Anapc2 UTSW 2 25272532 unclassified probably benign
R0415:Anapc2 UTSW 2 25278325 missense probably damaging 1.00
R1539:Anapc2 UTSW 2 25273063 missense probably benign
R1675:Anapc2 UTSW 2 25272639 missense possibly damaging 0.88
R1720:Anapc2 UTSW 2 25274712 missense probably benign 0.13
R2150:Anapc2 UTSW 2 25272670 missense probably benign 0.27
R2173:Anapc2 UTSW 2 25273276 missense probably benign 0.01
R4028:Anapc2 UTSW 2 25277738 missense probably damaging 1.00
R4254:Anapc2 UTSW 2 25273345 missense probably benign 0.08
R4643:Anapc2 UTSW 2 25276394 missense probably benign
R4742:Anapc2 UTSW 2 25273543 splice site probably null
R4824:Anapc2 UTSW 2 25277752 missense probably damaging 1.00
R5039:Anapc2 UTSW 2 25274796 missense possibly damaging 0.70
R5530:Anapc2 UTSW 2 25284583 missense possibly damaging 0.81
R6479:Anapc2 UTSW 2 25285395 missense probably benign 0.04
R6587:Anapc2 UTSW 2 25272538 unclassified probably benign
R7164:Anapc2 UTSW 2 25284999 missense probably damaging 1.00
R7494:Anapc2 UTSW 2 25276364 missense possibly damaging 0.95
R7829:Anapc2 UTSW 2 25277741 missense probably damaging 1.00
R8015:Anapc2 UTSW 2 25284676 missense probably benign 0.08
R8064:Anapc2 UTSW 2 25276406 missense probably benign
RF042:Anapc2 UTSW 2 25272561 unclassified probably benign
RF043:Anapc2 UTSW 2 25272561 unclassified probably benign
RF062:Anapc2 UTSW 2 25272537 frame shift probably null
X0025:Anapc2 UTSW 2 25279278 missense probably benign 0.01
Z1088:Anapc2 UTSW 2 25273368 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCACACTCTGACCTTAGTG -3'
(R):5'- CCAAATGGTGGCTGTTCTTCC -3'

Sequencing Primer
(F):5'- ACTCTGACCTTAGTGTTGTGC -3'
(R):5'- GCTGTTCTTCCACAGGCCG -3'
Posted On2018-06-06