Mutagenetix > Incidental Mutation

Incidental Mutation 'R6533:Spta1'

520162

Institutional Source

Beutler Lab

Gene Symbol

Spta1

Ensembl Gene

ENSMUSG00000026532

Gene Name

spectrin alpha, erythrocytic 1

Synonyms

erythroid, Spna-1, ihj, Spna1

MMRRC Submission

044659-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.854) question?

Stock #

R6533 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

174000342-174076016 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 174071713 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 2231 (T2231I)

Ref Sequence

ENSEMBL: ENSMUSP00000027817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027817] [ENSMUST00000214725]

AlphaFold

P08032

Predicted Effect

probably damaging
Transcript: ENSMUST00000027817
AA Change: T2231I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: T2231I

Domain	Start	End	E-Value	Type
SPEC	55	153	3.62e-11	SMART
SPEC	159	259	1.84e-26	SMART
SPEC	265	365	1.56e-24	SMART
SPEC	371	471	8.35e-25	SMART
SPEC	477	577	1.19e-29	SMART
SPEC	583	682	2.43e-26	SMART
SPEC	688	788	1.3e-26	SMART
SPEC	794	894	1.66e-28	SMART
SPEC	900	1077	5.03e-19	SMART
SH3	978	1033	2.98e-15	SMART
SPEC	1083	1178	2.57e-16	SMART
SPEC	1184	1284	1.15e-27	SMART
SPEC	1290	1390	7.05e-23	SMART
SPEC	1396	1495	6.04e-22	SMART
SPEC	1501	1602	1.15e-27	SMART
SPEC	1608	1708	5.46e-29	SMART
SPEC	1714	1814	1.08e-32	SMART
SPEC	1820	1921	2.17e-23	SMART
SPEC	1927	2028	2.19e-19	SMART
SPEC	2042	2142	3.87e-11	SMART
SPEC	2156	2253	9.77e-8	SMART
low complexity region	2307	2318	N/A	INTRINSIC
efhand_Ca_insen	2346	2414	2.37e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156092

Predicted Effect

probably benign
Transcript: ENSMUST00000214725

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010B08Rik	C	T	2: 173,561,628 (GRCm39)		probably benign	Het
4932414N04Rik	G	T	2: 68,546,662 (GRCm39)	E115*	probably null	Het
Abhd16a	G	A	17: 35,317,785 (GRCm39)		probably null	Het
Ankrd28	T	A	14: 31,454,041 (GRCm39)	I244L	possibly damaging	Het
Barx2	T	C	9: 31,824,275 (GRCm39)	Y38C	probably damaging	Het
Btn2a2	C	A	13: 23,665,951 (GRCm39)	E294*	probably null	Het
Ceacam2	C	G	7: 25,230,136 (GRCm39)	V157L	probably benign	Het
Ces2c	T	A	8: 105,578,725 (GRCm39)	F334L	possibly damaging	Het
Col7a1	T	C	9: 108,790,426 (GRCm39)	I958T	unknown	Het
Dcp2	T	A	18: 44,532,731 (GRCm39)	D82E	probably benign	Het
Dnah8	T	C	17: 30,965,964 (GRCm39)	L2432S	probably damaging	Het
Dst	A	G	1: 34,342,590 (GRCm39)	D7582G	probably benign	Het
Fat3	T	A	9: 15,910,195 (GRCm39)	I1936L	probably benign	Het
Gsdmc4	T	A	15: 63,763,909 (GRCm39)	N396I	probably damaging	Het
Lonrf2	A	C	1: 38,852,349 (GRCm39)	D167E	probably benign	Het
Marf1	T	C	16: 13,933,663 (GRCm39)	D1575G	probably benign	Het
Med23	T	C	10: 24,769,518 (GRCm39)	L101P	probably damaging	Het
Myh3	A	G	11: 66,981,245 (GRCm39)	I703V	probably damaging	Het
Ncan	G	A	8: 70,549,007 (GRCm39)	A1257V	probably benign	Het
Nipal4	A	T	11: 46,041,234 (GRCm39)	Y320*	probably null	Het
Obox5	A	T	7: 15,491,532 (GRCm39)	Q24L	probably benign	Het
Orc1	T	C	4: 108,454,644 (GRCm39)	S345P	probably benign	Het
P4hb	A	T	11: 120,462,469 (GRCm39)	I79N	probably damaging	Het
Phf3	A	T	1: 30,845,399 (GRCm39)	I1262N	probably damaging	Het
Pigo	A	T	4: 43,022,697 (GRCm39)	N291K	probably benign	Het
Ppargc1b	C	T	18: 61,440,845 (GRCm39)	R691H	possibly damaging	Het
Ppm1m	T	C	9: 106,074,069 (GRCm39)		probably benign	Het
Ptprd	A	T	4: 76,046,765 (GRCm39)	D500E	probably damaging	Het
Rab3gap2	T	A	1: 184,965,151 (GRCm39)		probably null	Het
Rnf214	A	G	9: 45,811,361 (GRCm39)	S101P	probably benign	Het
Sdhc	A	G	1: 170,957,396 (GRCm39)	S162P	possibly damaging	Het
Stxbp2	T	A	8: 3,692,683 (GRCm39)	D578E	probably benign	Het
Tacc2	A	T	7: 130,224,567 (GRCm39)	E417D	possibly damaging	Het
Tas2r144	A	T	6: 42,192,280 (GRCm39)	N7Y	probably benign	Het
Tasp1	A	G	2: 139,676,277 (GRCm39)	*421R	probably null	Het
Tigd5	A	G	15: 75,782,039 (GRCm39)	I134V	possibly damaging	Het
Tmem95	A	T	11: 69,768,843 (GRCm39)	M1K	probably null	Het
Trappc10	T	C	10: 78,024,728 (GRCm39)	M1134V	probably damaging	Het
Unc45a	T	G	7: 79,983,817 (GRCm39)	K326N	probably damaging	Het
Vmn1r59	A	G	7: 5,457,463 (GRCm39)	V99A	probably benign	Het
Vmn2r4	T	C	3: 64,322,519 (GRCm39)	T67A	probably benign	Het
Vmn2r85	A	T	10: 130,262,529 (GRCm39)	M70K	probably benign	Het
Zftraf1	C	A	15: 76,531,930 (GRCm39)	E283*	probably null	Het
Zkscan8	A	G	13: 21,704,748 (GRCm39)	F325S	probably damaging	Het

Other mutations in Spta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Spta1	APN	1	174,035,956 (GRCm39)	nonsense	probably null
IGL01095:Spta1	APN	1	174,041,051 (GRCm39)	missense	probably benign	0.02
IGL01144:Spta1	APN	1	174,014,829 (GRCm39)	missense	probably benign	0.05
IGL01455:Spta1	APN	1	174,030,877 (GRCm39)	missense	possibly damaging	0.78
IGL01541:Spta1	APN	1	174,044,725 (GRCm39)	missense	probably benign	0.03
IGL01613:Spta1	APN	1	174,035,960 (GRCm39)	missense	probably damaging	1.00
IGL01804:Spta1	APN	1	174,071,746 (GRCm39)	missense	probably benign	0.42
IGL01859:Spta1	APN	1	174,001,938 (GRCm39)	missense	probably damaging	1.00
IGL01898:Spta1	APN	1	174,041,428 (GRCm39)	missense	probably benign	0.00
IGL02106:Spta1	APN	1	174,030,860 (GRCm39)	missense	probably benign	0.02
IGL02166:Spta1	APN	1	174,017,797 (GRCm39)	missense	probably damaging	1.00
IGL02224:Spta1	APN	1	174,045,255 (GRCm39)	critical splice donor site	probably benign
IGL02318:Spta1	APN	1	174,002,029 (GRCm39)	missense	possibly damaging	0.51
IGL02392:Spta1	APN	1	174,046,380 (GRCm39)	missense	probably damaging	0.96
IGL02852:Spta1	APN	1	174,071,676 (GRCm39)	missense	probably benign	0.24
IGL02861:Spta1	APN	1	174,039,164 (GRCm39)	missense	probably damaging	1.00
IGL02982:Spta1	APN	1	174,014,854 (GRCm39)	missense	probably benign	0.00
IGL03057:Spta1	APN	1	174,008,624 (GRCm39)	missense	probably benign	0.19
IGL03215:Spta1	APN	1	174,046,309 (GRCm39)	missense	probably damaging	1.00
IGL03263:Spta1	APN	1	174,041,484 (GRCm39)	missense	probably damaging	0.99
IGL03272:Spta1	APN	1	174,041,710 (GRCm39)	missense	probably benign	0.08
bounced	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
Capillus	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
Deflection	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
Goldfoil	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
hanging	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
Klimt	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
Rutherford	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
Thread	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
H8786:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0003:Spta1	UTSW	1	174,032,839 (GRCm39)	missense	probably damaging	0.98
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0010:Spta1	UTSW	1	174,045,509 (GRCm39)	missense	probably benign	0.03
R0078:Spta1	UTSW	1	174,034,598 (GRCm39)	splice site	probably benign
R0172:Spta1	UTSW	1	174,058,352 (GRCm39)	missense	probably damaging	1.00
R0206:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0208:Spta1	UTSW	1	174,020,526 (GRCm39)	missense	probably damaging	1.00
R0276:Spta1	UTSW	1	174,045,460 (GRCm39)	missense	probably damaging	1.00
R0288:Spta1	UTSW	1	174,070,745 (GRCm39)	missense	probably damaging	0.99
R0323:Spta1	UTSW	1	174,046,017 (GRCm39)	missense	probably damaging	1.00
R0454:Spta1	UTSW	1	174,041,508 (GRCm39)	missense	probably damaging	1.00
R0508:Spta1	UTSW	1	174,052,023 (GRCm39)	missense	probably damaging	1.00
R0698:Spta1	UTSW	1	174,008,670 (GRCm39)	missense	probably damaging	1.00
R0751:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R0925:Spta1	UTSW	1	174,001,992 (GRCm39)	missense	possibly damaging	0.85
R0941:Spta1	UTSW	1	174,072,771 (GRCm39)	unclassified	probably benign
R1131:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R1171:Spta1	UTSW	1	174,039,180 (GRCm39)	nonsense	probably null
R1184:Spta1	UTSW	1	174,012,256 (GRCm39)	missense	probably damaging	1.00
R1401:Spta1	UTSW	1	174,050,250 (GRCm39)	missense	probably damaging	1.00
R1489:Spta1	UTSW	1	174,058,891 (GRCm39)	missense	probably damaging	0.97
R1532:Spta1	UTSW	1	174,074,919 (GRCm39)	missense	probably damaging	0.99
R1551:Spta1	UTSW	1	174,067,732 (GRCm39)	missense	possibly damaging	0.94
R1555:Spta1	UTSW	1	174,006,315 (GRCm39)	missense	probably damaging	0.99
R1566:Spta1	UTSW	1	174,012,272 (GRCm39)	missense	probably benign	0.00
R1586:Spta1	UTSW	1	174,041,061 (GRCm39)	missense	probably benign	0.00
R1676:Spta1	UTSW	1	174,007,405 (GRCm39)	missense	probably damaging	0.98
R1711:Spta1	UTSW	1	174,068,608 (GRCm39)	missense	probably damaging	1.00
R1795:Spta1	UTSW	1	174,073,296 (GRCm39)	missense	probably damaging	1.00
R1823:Spta1	UTSW	1	174,074,115 (GRCm39)	missense	probably benign	0.05
R1842:Spta1	UTSW	1	174,023,513 (GRCm39)	missense	probably benign	0.00
R1867:Spta1	UTSW	1	174,047,405 (GRCm39)	missense	probably benign	0.33
R1970:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	possibly damaging	0.88
R2042:Spta1	UTSW	1	174,039,213 (GRCm39)	missense	probably benign	0.20
R2095:Spta1	UTSW	1	174,071,764 (GRCm39)	missense	possibly damaging	0.75
R2125:Spta1	UTSW	1	174,035,910 (GRCm39)	missense	possibly damaging	0.80
R2145:Spta1	UTSW	1	174,040,180 (GRCm39)	missense	probably benign	0.00
R2158:Spta1	UTSW	1	174,056,824 (GRCm39)	missense	probably benign	0.41
R2187:Spta1	UTSW	1	174,020,532 (GRCm39)	missense	probably damaging	1.00
R2250:Spta1	UTSW	1	174,071,680 (GRCm39)	missense	probably damaging	1.00
R2258:Spta1	UTSW	1	174,001,907 (GRCm39)	missense	possibly damaging	0.76
R2319:Spta1	UTSW	1	174,006,222 (GRCm39)	critical splice acceptor site	probably null
R3782:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R4058:Spta1	UTSW	1	174,068,703 (GRCm39)	missense	probably damaging	1.00
R4080:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4081:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4082:Spta1	UTSW	1	174,041,632 (GRCm39)	missense	probably benign	0.00
R4108:Spta1	UTSW	1	174,002,122 (GRCm39)	missense	probably benign	0.01
R4115:Spta1	UTSW	1	174,067,923 (GRCm39)	missense	probably damaging	1.00
R4303:Spta1	UTSW	1	174,007,418 (GRCm39)	missense	probably damaging	1.00
R4419:Spta1	UTSW	1	174,074,990 (GRCm39)	nonsense	probably null
R4525:Spta1	UTSW	1	174,034,676 (GRCm39)	missense	probably null	1.00
R4614:Spta1	UTSW	1	174,020,543 (GRCm39)	missense	probably damaging	1.00
R4673:Spta1	UTSW	1	174,018,628 (GRCm39)	splice site	probably null
R4782:Spta1	UTSW	1	174,058,232 (GRCm39)	missense	probably benign	0.01
R4825:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R4829:Spta1	UTSW	1	174,065,493 (GRCm39)	missense	probably benign	0.01
R4873:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4875:Spta1	UTSW	1	174,003,396 (GRCm39)	missense	probably damaging	1.00
R4898:Spta1	UTSW	1	174,065,400 (GRCm39)	missense	possibly damaging	0.94
R4910:Spta1	UTSW	1	174,045,429 (GRCm39)	splice site	probably null
R4911:Spta1	UTSW	1	174,013,213 (GRCm39)	missense	probably damaging	1.00
R4928:Spta1	UTSW	1	174,018,622 (GRCm39)	missense	probably benign	0.15
R4959:Spta1	UTSW	1	174,074,174 (GRCm39)	missense	probably damaging	0.97
R5009:Spta1	UTSW	1	174,067,789 (GRCm39)	missense	possibly damaging	0.62
R5149:Spta1	UTSW	1	174,075,000 (GRCm39)	missense	probably damaging	0.99
R5293:Spta1	UTSW	1	174,023,551 (GRCm39)	missense	probably damaging	0.99
R5421:Spta1	UTSW	1	174,043,095 (GRCm39)	missense	probably damaging	0.99
R5457:Spta1	UTSW	1	174,044,759 (GRCm39)	missense	probably damaging	1.00
R5590:Spta1	UTSW	1	174,003,336 (GRCm39)	missense	possibly damaging	0.73
R5606:Spta1	UTSW	1	174,047,468 (GRCm39)	missense	probably damaging	1.00
R5736:Spta1	UTSW	1	174,041,821 (GRCm39)	critical splice donor site	probably null
R5834:Spta1	UTSW	1	174,012,363 (GRCm39)	splice site	probably null
R5845:Spta1	UTSW	1	174,068,662 (GRCm39)	missense	probably damaging	0.97
R5987:Spta1	UTSW	1	174,050,894 (GRCm39)	missense	probably damaging	1.00
R6102:Spta1	UTSW	1	174,052,086 (GRCm39)	missense	probably benign	0.01
R6221:Spta1	UTSW	1	174,009,342 (GRCm39)	missense	probably damaging	1.00
R6276:Spta1	UTSW	1	174,046,078 (GRCm39)	missense	probably damaging	1.00
R6317:Spta1	UTSW	1	174,068,653 (GRCm39)	missense	probably damaging	1.00
R6329:Spta1	UTSW	1	174,041,743 (GRCm39)	missense	possibly damaging	0.60
R6352:Spta1	UTSW	1	174,039,212 (GRCm39)	missense	possibly damaging	0.94
R6374:Spta1	UTSW	1	174,041,734 (GRCm39)	missense	probably damaging	1.00
R6376:Spta1	UTSW	1	174,030,888 (GRCm39)	missense	probably benign
R6387:Spta1	UTSW	1	174,058,899 (GRCm39)	missense	probably benign	0.01
R6451:Spta1	UTSW	1	174,044,767 (GRCm39)	missense	probably damaging	0.97
R6480:Spta1	UTSW	1	174,014,714 (GRCm39)	splice site	probably null
R6585:Spta1	UTSW	1	174,006,251 (GRCm39)	missense	probably damaging	1.00
R6695:Spta1	UTSW	1	174,071,608 (GRCm39)	critical splice acceptor site	probably null
R6945:Spta1	UTSW	1	174,036,891 (GRCm39)	missense	possibly damaging	0.89
R7020:Spta1	UTSW	1	174,036,918 (GRCm39)	missense	probably damaging	1.00
R7086:Spta1	UTSW	1	174,027,050 (GRCm39)	missense	probably damaging	0.98
R7087:Spta1	UTSW	1	174,002,076 (GRCm39)	missense	probably benign
R7151:Spta1	UTSW	1	174,025,317 (GRCm39)	missense	probably damaging	1.00
R7193:Spta1	UTSW	1	174,012,178 (GRCm39)	missense	probably damaging	1.00
R7199:Spta1	UTSW	1	174,050,837 (GRCm39)	missense	possibly damaging	0.61
R7219:Spta1	UTSW	1	174,050,203 (GRCm39)	missense	probably damaging	0.96
R7343:Spta1	UTSW	1	174,050,915 (GRCm39)	missense	probably damaging	0.99
R7372:Spta1	UTSW	1	174,025,201 (GRCm39)	nonsense	probably null
R7472:Spta1	UTSW	1	174,074,065 (GRCm39)	missense	probably damaging	1.00
R7516:Spta1	UTSW	1	174,025,349 (GRCm39)	missense	probably damaging	1.00
R7627:Spta1	UTSW	1	174,032,944 (GRCm39)	missense	probably damaging	1.00
R7770:Spta1	UTSW	1	174,023,547 (GRCm39)	nonsense	probably null
R7784:Spta1	UTSW	1	174,030,017 (GRCm39)	missense	probably damaging	1.00
R7804:Spta1	UTSW	1	174,023,471 (GRCm39)	missense	possibly damaging	0.50
R7854:Spta1	UTSW	1	174,046,396 (GRCm39)	critical splice donor site	probably null
R7862:Spta1	UTSW	1	174,025,351 (GRCm39)	critical splice donor site	probably null
R7958:Spta1	UTSW	1	174,001,956 (GRCm39)	missense	probably benign	0.03
R8015:Spta1	UTSW	1	174,067,737 (GRCm39)	missense	probably damaging	1.00
R8059:Spta1	UTSW	1	174,045,936 (GRCm39)	intron	probably benign
R8076:Spta1	UTSW	1	174,014,797 (GRCm39)	missense	probably benign	0.00
R8152:Spta1	UTSW	1	174,045,510 (GRCm39)	missense	probably benign	0.03
R8235:Spta1	UTSW	1	174,029,952 (GRCm39)	missense	probably damaging	1.00
R8284:Spta1	UTSW	1	174,007,387 (GRCm39)	missense	probably benign	0.00
R8298:Spta1	UTSW	1	174,074,953 (GRCm39)	missense	probably damaging	1.00
R8312:Spta1	UTSW	1	174,067,777 (GRCm39)	missense	probably damaging	1.00
R8495:Spta1	UTSW	1	174,043,051 (GRCm39)	missense	probably benign	0.00
R8550:Spta1	UTSW	1	174,014,774 (GRCm39)	missense	probably damaging	1.00
R8675:Spta1	UTSW	1	174,058,249 (GRCm39)	missense	probably benign	0.01
R8757:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8759:Spta1	UTSW	1	174,040,940 (GRCm39)	missense	probably damaging	1.00
R8848:Spta1	UTSW	1	174,025,310 (GRCm39)	missense	probably benign	0.05
R8883:Spta1	UTSW	1	174,021,145 (GRCm39)	missense	possibly damaging	0.82
R8884:Spta1	UTSW	1	174,045,254 (GRCm39)	critical splice donor site	probably null
R8896:Spta1	UTSW	1	174,045,548 (GRCm39)	missense	probably damaging	1.00
R8953:Spta1	UTSW	1	174,058,241 (GRCm39)	missense	probably benign	0.10
R9006:Spta1	UTSW	1	174,047,537 (GRCm39)	missense	probably damaging	1.00
R9013:Spta1	UTSW	1	174,050,174 (GRCm39)	missense	probably damaging	1.00
R9077:Spta1	UTSW	1	174,045,170 (GRCm39)	missense	probably damaging	1.00
R9129:Spta1	UTSW	1	174,058,911 (GRCm39)	missense	possibly damaging	0.77
R9207:Spta1	UTSW	1	174,039,139 (GRCm39)	missense	probably benign	0.01
R9229:Spta1	UTSW	1	174,067,750 (GRCm39)	missense	probably damaging	1.00
R9281:Spta1	UTSW	1	174,047,444 (GRCm39)	missense	probably damaging	1.00
R9290:Spta1	UTSW	1	174,045,204 (GRCm39)	missense	possibly damaging	0.94
R9307:Spta1	UTSW	1	174,035,978 (GRCm39)	missense	probably damaging	1.00
R9489:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9605:Spta1	UTSW	1	174,035,880 (GRCm39)	missense	probably damaging	1.00
R9685:Spta1	UTSW	1	174,032,925 (GRCm39)	missense	probably damaging	1.00
RF002:Spta1	UTSW	1	174,058,926 (GRCm39)	missense	possibly damaging	0.62
RF018:Spta1	UTSW	1	174,036,885 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,045,469 (GRCm39)	missense	probably damaging	1.00
RF020:Spta1	UTSW	1	174,041,010 (GRCm39)	missense	probably benign	0.42
T0722:Spta1	UTSW	1	174,018,632 (GRCm39)	splice site	probably benign
X0028:Spta1	UTSW	1	174,052,016 (GRCm39)	missense	probably damaging	1.00
Z1176:Spta1	UTSW	1	174,067,933 (GRCm39)	missense	probably damaging	0.99
Z1176:Spta1	UTSW	1	174,018,617 (GRCm39)	missense	probably damaging	1.00
Z1177:Spta1	UTSW	1	174,073,255 (GRCm39)	missense	probably benign	0.02
Z1177:Spta1	UTSW	1	174,017,728 (GRCm39)	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TCTGAGTTCCAGGATGACAACC -3'
(R):5'- AACGGAACATCTCTGTAAGTGCTC -3'

Sequencing Primer
(F):5'- TCATCTCACAGCTGTTTTTCAAAGGG -3'
(R):5'- AAGTGCTCTTTATCAGGTGCC -3'

Posted On

2018-06-06