Incidental Mutation 'R6456:AU040320'
ID520163
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126842491 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 789 (N789S)
Ref Sequence ENSEMBL: ENSMUSP00000037802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
Predicted Effect probably benign
Transcript: ENSMUST00000047431
AA Change: N789S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: N789S

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102607
AA Change: N789S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: N789S

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102608
AA Change: N789S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: N789S

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155341
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cd180 C T 13: 102,702,836 L76F probably damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1767:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R2414:AU040320 UTSW 4 126868691 critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126835695 missense probably damaging 1.00
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5085:AU040320 UTSW 4 126828871 missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126791930 missense probably damaging 1.00
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
R7492:AU040320 UTSW 4 126847855 missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126792264 missense probably benign 0.01
R7702:AU040320 UTSW 4 126814373 missense probably benign 0.23
R7733:AU040320 UTSW 4 126835529 missense possibly damaging 0.88
Z1177:AU040320 UTSW 4 126842633 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGTTCTCAGGGTAATGGGAAGC -3'
(R):5'- AGAACCCCAAGGCCTTCCTATG -3'

Sequencing Primer
(F):5'- GTAATGGGAAGCCTTAAACCAGCTC -3'
(R):5'- AAGGCCTTCCTATGGTCCC -3'
Posted On2018-06-06