Mutagenetix > Incidental Mutation

Incidental Mutation 'R6533:Ncan'

520193

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6533 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70096357 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1257 (A1257V)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000002412
AA Change: A1257V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: A1257V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.2%

Validation Efficiency

100% (44/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010B08Rik	C	T	2: 173,719,835		probably benign	Het
4932414N04Rik	G	T	2: 68,716,318	E115*	probably null	Het
Abhd16a	G	A	17: 35,098,809		probably null	Het
Ankrd28	T	A	14: 31,732,084	I244L	possibly damaging	Het
Barx2	T	C	9: 31,912,979	Y38C	probably damaging	Het
Btn2a2	C	A	13: 23,481,781	E294*	probably null	Het
Ceacam2	C	G	7: 25,530,711	V157L	probably benign	Het
Ces2c	T	A	8: 104,852,093	F334L	possibly damaging	Het
Col7a1	T	C	9: 108,961,358	I958T	unknown	Het
Cyhr1	C	A	15: 76,647,730	E283*	probably null	Het
Dcp2	T	A	18: 44,399,664	D82E	probably benign	Het
Dnah8	T	C	17: 30,746,990	L2432S	probably damaging	Het
Dst	A	G	1: 34,303,509	D7582G	probably benign	Het
Fat3	T	A	9: 15,998,899	I1936L	probably benign	Het
Gsdmc4	T	A	15: 63,892,060	N396I	probably damaging	Het
Lonrf2	A	C	1: 38,813,268	D167E	probably benign	Het
Marf1	T	C	16: 14,115,799	D1575G	probably benign	Het
Med23	T	C	10: 24,893,620	L101P	probably damaging	Het
Myh3	A	G	11: 67,090,419	I703V	probably damaging	Het
Nipal4	A	T	11: 46,150,407	Y320*	probably null	Het
Obox5	A	T	7: 15,757,607	Q24L	probably benign	Het
Orc1	T	C	4: 108,597,447	S345P	probably benign	Het
P4hb	A	T	11: 120,571,643	I79N	probably damaging	Het
Phf3	A	T	1: 30,806,318	I1262N	probably damaging	Het
Pigo	A	T	4: 43,022,697	N291K	probably benign	Het
Ppargc1b	C	T	18: 61,307,774	R691H	possibly damaging	Het
Ppm1m	T	C	9: 106,196,870		probably benign	Het
Ptprd	A	T	4: 76,128,528	D500E	probably damaging	Het
Rab3gap2	T	A	1: 185,232,954		probably null	Het
Rnf214	A	G	9: 45,900,063	S101P	probably benign	Het
Sdhc	A	G	1: 171,129,827	S162P	possibly damaging	Het
Spta1	C	T	1: 174,244,147	T2231I	probably damaging	Het
Stxbp2	T	A	8: 3,642,683	D578E	probably benign	Het
Tacc2	A	T	7: 130,622,837	E417D	possibly damaging	Het
Tas2r144	A	T	6: 42,215,346	N7Y	probably benign	Het
Tasp1	A	G	2: 139,834,357	*421R	probably null	Het
Tigd5	A	G	15: 75,910,190	I134V	possibly damaging	Het
Tmem95	A	T	11: 69,878,017	M1K	probably null	Het
Trappc10	T	C	10: 78,188,894	M1134V	probably damaging	Het
Unc45a	T	G	7: 80,334,069	K326N	probably damaging	Het
Vmn1r59	A	G	7: 5,454,464	V99A	probably benign	Het
Vmn2r4	T	C	3: 64,415,098	T67A	probably benign	Het
Vmn2r85	A	T	10: 130,426,660	M70K	probably benign	Het
Zkscan8	A	G	13: 21,520,578	F325S	probably damaging	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R5915:Ncan	UTSW	8	70098081	nonsense	probably null
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTAATGGCTGGGAAGTGACCTAG -3'
(R):5'- CTTTGCATCCCTCTGAGGAG -3'

Sequencing Primer
(F):5'- TTCCAGGAGGACCTCAGTAACAG -3'
(R):5'- TCTGAGGAGGCCAGTGG -3'

Posted On

2018-06-06