Incidental Mutation 'R6533:Med23'
ID520205
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6533 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24893620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 101 (L101P)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
Predicted Effect probably damaging
Transcript: ENSMUST00000020159
AA Change: L461P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: L461P

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: L467P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: L467P

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: L101P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: L101P

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176502
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179967
Meta Mutation Damage Score 0.9636 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,835 probably benign Het
4932414N04Rik G T 2: 68,716,318 E115* probably null Het
Abhd16a G A 17: 35,098,809 probably null Het
Ankrd28 T A 14: 31,732,084 I244L possibly damaging Het
Barx2 T C 9: 31,912,979 Y38C probably damaging Het
Btn2a2 C A 13: 23,481,781 E294* probably null Het
Ceacam2 C G 7: 25,530,711 V157L probably benign Het
Ces2c T A 8: 104,852,093 F334L possibly damaging Het
Col7a1 T C 9: 108,961,358 I958T unknown Het
Cyhr1 C A 15: 76,647,730 E283* probably null Het
Dcp2 T A 18: 44,399,664 D82E probably benign Het
Dnah8 T C 17: 30,746,990 L2432S probably damaging Het
Dst A G 1: 34,303,509 D7582G probably benign Het
Fat3 T A 9: 15,998,899 I1936L probably benign Het
Gsdmc4 T A 15: 63,892,060 N396I probably damaging Het
Lonrf2 A C 1: 38,813,268 D167E probably benign Het
Marf1 T C 16: 14,115,799 D1575G probably benign Het
Myh3 A G 11: 67,090,419 I703V probably damaging Het
Ncan G A 8: 70,096,357 A1257V probably benign Het
Nipal4 A T 11: 46,150,407 Y320* probably null Het
Obox5 A T 7: 15,757,607 Q24L probably benign Het
Orc1 T C 4: 108,597,447 S345P probably benign Het
P4hb A T 11: 120,571,643 I79N probably damaging Het
Phf3 A T 1: 30,806,318 I1262N probably damaging Het
Pigo A T 4: 43,022,697 N291K probably benign Het
Ppargc1b C T 18: 61,307,774 R691H possibly damaging Het
Ppm1m T C 9: 106,196,870 probably benign Het
Ptprd A T 4: 76,128,528 D500E probably damaging Het
Rab3gap2 T A 1: 185,232,954 probably null Het
Rnf214 A G 9: 45,900,063 S101P probably benign Het
Sdhc A G 1: 171,129,827 S162P possibly damaging Het
Spta1 C T 1: 174,244,147 T2231I probably damaging Het
Stxbp2 T A 8: 3,642,683 D578E probably benign Het
Tacc2 A T 7: 130,622,837 E417D possibly damaging Het
Tas2r144 A T 6: 42,215,346 N7Y probably benign Het
Tasp1 A G 2: 139,834,357 *421R probably null Het
Tigd5 A G 15: 75,910,190 I134V possibly damaging Het
Tmem95 A T 11: 69,878,017 M1K probably null Het
Trappc10 T C 10: 78,188,894 M1134V probably damaging Het
Unc45a T G 7: 80,334,069 K326N probably damaging Het
Vmn1r59 A G 7: 5,454,464 V99A probably benign Het
Vmn2r4 T C 3: 64,415,098 T67A probably benign Het
Vmn2r85 A T 10: 130,426,660 M70K probably benign Het
Zkscan8 A G 13: 21,520,578 F325S probably damaging Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 splice site probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R2566:Med23 UTSW 10 24888575 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7530:Med23 UTSW 10 24905953 missense probably benign 0.00
R7643:Med23 UTSW 10 24905965 missense probably benign 0.01
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
R7764:Med23 UTSW 10 24909920 critical splice donor site probably null
R7784:Med23 UTSW 10 24902448 missense probably damaging 1.00
R8024:Med23 UTSW 10 24879683 missense possibly damaging 0.74
R8182:Med23 UTSW 10 24912807 missense probably benign
R8412:Med23 UTSW 10 24908734 missense probably benign 0.01
R8874:Med23 UTSW 10 24895719 missense possibly damaging 0.92
RF003:Med23 UTSW 10 24903785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCCATCTGCAATATTACC -3'
(R):5'- CAGTGAATCCAGGAGGTTCATC -3'

Sequencing Primer
(F):5'- TTACCCAAGCTTTAATAGGTACAGCC -3'
(R):5'- GTCACTGATGCTGAGGCCAAAC -3'
Posted On2018-06-06