Incidental Mutation 'R6456:Cd180'
ID520216
Institutional Source Beutler Lab
Gene Symbol Cd180
Ensembl Gene ENSMUSG00000021624
Gene NameCD180 antigen
SynonymsLy78, RP105
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6456 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location102693558-102739629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102702836 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 76 (L76F)
Ref Sequence ENSEMBL: ENSMUSP00000022124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]
PDB Structure
Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000022124
AA Change: L76F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: L76F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 76 99 1.07e0 SMART
LRR 193 221 1.76e2 SMART
LRR 297 320 1.66e1 SMART
Pfam:LRR_8 321 382 4.2e-13 PFAM
LRR 395 418 3e1 SMART
LRR 444 467 3.09e1 SMART
LRR 495 518 4.97e0 SMART
LRR 519 542 2.4e1 SMART
low complexity region 555 567 N/A INTRINSIC
LRRCT 577 626 5.11e-8 SMART
transmembrane domain 628 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167144
SMART Domains Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170878
AA Change: L76F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624
AA Change: L76F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000171267
AA Change: L76F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624
AA Change: L76F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 2e-38 PDB
SCOP:d1m0za_ 35 84 9e-4 SMART
Blast:LRR 51 75 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,685,169 H310L probably damaging Het
9930021J03Rik G A 19: 29,716,514 P1860S possibly damaging Het
Abca13 A T 11: 9,290,474 H779L possibly damaging Het
Abca7 T C 10: 80,015,150 V2097A probably null Het
Adam8 A G 7: 139,986,788 S524P possibly damaging Het
Anapc2 T C 2: 25,280,195 M575T probably damaging Het
Arhgap42 T A 9: 9,005,822 I736L probably benign Het
AU040320 A G 4: 126,842,491 N789S probably benign Het
Bmi1 A G 2: 18,682,247 Y46C probably damaging Het
Ccdc125 T C 13: 100,696,309 S465P possibly damaging Het
Cep135 T C 5: 76,591,724 probably benign Het
Col6a5 G A 9: 105,945,477 T227I unknown Het
Cyp4a29 G T 4: 115,251,184 M368I probably benign Het
Ddx28 T A 8: 106,010,368 I353F possibly damaging Het
Ddx58 T A 4: 40,213,838 N607Y possibly damaging Het
Dhx40 G A 11: 86,784,974 T198M probably damaging Het
Fam71f1 A G 6: 29,334,046 N299S probably benign Het
Fat4 G A 3: 38,983,979 V3927M possibly damaging Het
Gm10226 G T 17: 21,692,025 G56* probably null Het
Gm11127 A T 17: 36,056,610 Y279N probably damaging Het
Itsn2 T G 12: 4,629,923 probably benign Het
Lrrc8a A G 2: 30,255,474 D100G probably benign Het
Madd T C 2: 91,178,191 H122R probably benign Het
Mfsd4b3 C G 10: 39,947,320 V315L probably benign Het
Mki67 C G 7: 135,699,475 A1277P possibly damaging Het
Nlrp9b T A 7: 20,048,778 N872K probably damaging Het
Npas1 T C 7: 16,461,926 T274A probably benign Het
Nrm A T 17: 35,865,400 probably null Het
Olfr418 A T 1: 173,270,538 D121V probably damaging Het
Pdilt T A 7: 119,500,483 L187F probably damaging Het
Pkdcc T C 17: 83,220,119 I242T probably damaging Het
Plch2 C A 4: 154,993,002 D535Y probably damaging Het
Pmpca T A 2: 26,395,167 I468N probably damaging Het
Prpf4 T C 4: 62,414,632 probably null Het
Rcc1 A G 4: 132,334,116 S361P probably benign Het
Rnf213 A G 11: 119,459,966 I3876V probably benign Het
Sall2 T A 14: 52,313,593 Q715L probably damaging Het
Sall2 G A 14: 52,313,594 Q713* probably null Het
Sin3a A G 9: 57,113,701 S1004G possibly damaging Het
Sltm C T 9: 70,542,987 T23M probably damaging Het
Sspo A G 6: 48,451,806 E385G probably benign Het
Syne3 G T 12: 104,940,704 R775S possibly damaging Het
Szt2 A T 4: 118,376,697 probably benign Het
Tlk2 T C 11: 105,221,273 S151P probably benign Het
Trabd2b C T 4: 114,586,560 R305C probably damaging Het
Ttc21b T C 2: 66,188,331 Q1244R probably damaging Het
Vmn2r125 A G 4: 156,351,062 N245S probably benign Het
Wdr34 T C 2: 30,032,767 S323G probably benign Het
Wdr64 G A 1: 175,785,609 probably null Het
Wdr70 G A 15: 7,885,637 T550M possibly damaging Het
Wdr78 A C 4: 103,049,549 M689R probably benign Het
Other mutations in Cd180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cd180 APN 13 102705409 missense probably benign
IGL00949:Cd180 APN 13 102693760 missense possibly damaging 0.89
IGL01864:Cd180 APN 13 102706033 missense possibly damaging 0.93
IGL01901:Cd180 APN 13 102706428 missense probably benign 0.04
IGL01934:Cd180 APN 13 102702858 missense probably damaging 1.00
IGL01998:Cd180 APN 13 102705214 missense probably damaging 0.99
IGL02336:Cd180 APN 13 102705313 missense probably damaging 0.98
IGL03031:Cd180 APN 13 102705027 missense probably benign 0.00
IGL03139:Cd180 APN 13 102706416 missense probably damaging 1.00
Volte_face UTSW 13 102704923 missense probably damaging 0.99
H8562:Cd180 UTSW 13 102705418 missense probably benign 0.02
R0004:Cd180 UTSW 13 102702708 missense probably benign 0.00
R0393:Cd180 UTSW 13 102705900 missense probably damaging 0.99
R0565:Cd180 UTSW 13 102702874 intron probably benign
R1080:Cd180 UTSW 13 102706220 nonsense probably null
R1223:Cd180 UTSW 13 102706222 missense possibly damaging 0.49
R1669:Cd180 UTSW 13 102705490 missense probably damaging 1.00
R1772:Cd180 UTSW 13 102706242 missense probably benign 0.11
R1784:Cd180 UTSW 13 102705859 missense probably damaging 1.00
R1865:Cd180 UTSW 13 102706009 missense probably benign
R2252:Cd180 UTSW 13 102706398 nonsense probably null
R2385:Cd180 UTSW 13 102705183 missense probably benign 0.00
R4653:Cd180 UTSW 13 102704908 missense probably damaging 1.00
R4695:Cd180 UTSW 13 102705760 missense probably benign 0.01
R4790:Cd180 UTSW 13 102702822 missense probably damaging 0.98
R4934:Cd180 UTSW 13 102739164 critical splice acceptor site probably null
R5052:Cd180 UTSW 13 102704895 missense probably benign
R5154:Cd180 UTSW 13 102705774 missense probably damaging 1.00
R5469:Cd180 UTSW 13 102704834 missense probably benign 0.37
R5493:Cd180 UTSW 13 102706141 missense probably benign 0.07
R5615:Cd180 UTSW 13 102706203 missense probably benign 0.34
R5905:Cd180 UTSW 13 102706033 missense possibly damaging 0.93
R6282:Cd180 UTSW 13 102693757 missense possibly damaging 0.90
R6433:Cd180 UTSW 13 102705633 missense probably benign 0.00
R6784:Cd180 UTSW 13 102702705 missense probably damaging 0.97
R6815:Cd180 UTSW 13 102705429 missense probably damaging 1.00
R6838:Cd180 UTSW 13 102702731 missense probably benign 0.38
R6941:Cd180 UTSW 13 102706191 missense probably benign 0.23
R7048:Cd180 UTSW 13 102704923 missense probably damaging 0.99
R7338:Cd180 UTSW 13 102706428 missense probably benign 0.04
R7466:Cd180 UTSW 13 102704995 missense probably damaging 1.00
R7647:Cd180 UTSW 13 102705943 missense probably damaging 1.00
R8179:Cd180 UTSW 13 102705633 missense probably benign 0.00
R8252:Cd180 UTSW 13 102705996 missense probably benign 0.00
R8300:Cd180 UTSW 13 102704793 missense probably benign 0.01
R8460:Cd180 UTSW 13 102702846 missense probably damaging 1.00
Z1176:Cd180 UTSW 13 102705766 missense probably damaging 1.00
Z1177:Cd180 UTSW 13 102706032 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGTGAATCAAACTACTGAATCCAG -3'
(R):5'- CTCTACTAAGGCAGAGCTAGAGAACAG -3'

Sequencing Primer
(F):5'- CTGGCACTTTACCAAACTC -3'
(R):5'- AATAGCACTCGGAATGCATTTC -3'
Posted On2018-06-06