Mutagenetix > Incidental Mutations

Incidental Mutation 'R6456:Cd180'

520216

Institutional Source

Beutler Lab

Gene Symbol

Cd180

Ensembl Gene

ENSMUSG00000021624

Gene Name

CD180 antigen

Synonyms

Ly78, RP105

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6456 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102693558-102739629 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102702836 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 76 (L76F)

Ref Sequence

ENSEMBL: ENSMUSP00000022124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]

PDB Structure

Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022124
AA Change: L76F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: L76F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LRR	76	99	1.07e0	SMART
LRR	193	221	1.76e2	SMART
LRR	297	320	1.66e1	SMART
Pfam:LRR_8	321	382	4.2e-13	PFAM
LRR	395	418	3e1	SMART
LRR	444	467	3.09e1	SMART
LRR	495	518	4.97e0	SMART
LRR	519	542	2.4e1	SMART
low complexity region	555	567	N/A	INTRINSIC
LRRCT	577	626	5.11e-8	SMART
transmembrane domain	628	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167144

SMART Domains

Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170878
AA Change: L76F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624
AA Change: L76F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000171267
AA Change: L76F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624
AA Change: L76F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	2e-38	PDB
SCOP:d1m0za_	35	84	9e-4	SMART
Blast:LRR	51	75	7e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.4%
20x: 91.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	T	A	1: 26,685,169	H310L	probably damaging	Het
9930021J03Rik	G	A	19: 29,716,514	P1860S	possibly damaging	Het
Abca13	A	T	11: 9,290,474	H779L	possibly damaging	Het
Abca7	T	C	10: 80,015,150	V2097A	probably null	Het
Adam8	A	G	7: 139,986,788	S524P	possibly damaging	Het
Anapc2	T	C	2: 25,280,195	M575T	probably damaging	Het
Arhgap42	T	A	9: 9,005,822	I736L	probably benign	Het
AU040320	A	G	4: 126,842,491	N789S	probably benign	Het
Bmi1	A	G	2: 18,682,247	Y46C	probably damaging	Het
Ccdc125	T	C	13: 100,696,309	S465P	possibly damaging	Het
Cep135	T	C	5: 76,591,724		probably benign	Het
Col6a5	G	A	9: 105,945,477	T227I	unknown	Het
Cyp4a29	G	T	4: 115,251,184	M368I	probably benign	Het
Ddx28	T	A	8: 106,010,368	I353F	possibly damaging	Het
Ddx58	T	A	4: 40,213,838	N607Y	possibly damaging	Het
Dhx40	G	A	11: 86,784,974	T198M	probably damaging	Het
Fam71f1	A	G	6: 29,334,046	N299S	probably benign	Het
Fat4	G	A	3: 38,983,979	V3927M	possibly damaging	Het
Gm10226	G	T	17: 21,692,025	G56*	probably null	Het
Gm11127	A	T	17: 36,056,610	Y279N	probably damaging	Het
Itsn2	T	G	12: 4,629,923		probably benign	Het
Lrrc8a	A	G	2: 30,255,474	D100G	probably benign	Het
Madd	T	C	2: 91,178,191	H122R	probably benign	Het
Mfsd4b3	C	G	10: 39,947,320	V315L	probably benign	Het
Mki67	C	G	7: 135,699,475	A1277P	possibly damaging	Het
Nlrp9b	T	A	7: 20,048,778	N872K	probably damaging	Het
Npas1	T	C	7: 16,461,926	T274A	probably benign	Het
Nrm	A	T	17: 35,865,400		probably null	Het
Olfr418	A	T	1: 173,270,538	D121V	probably damaging	Het
Pdilt	T	A	7: 119,500,483	L187F	probably damaging	Het
Pkdcc	T	C	17: 83,220,119	I242T	probably damaging	Het
Plch2	C	A	4: 154,993,002	D535Y	probably damaging	Het
Pmpca	T	A	2: 26,395,167	I468N	probably damaging	Het
Prpf4	T	C	4: 62,414,632		probably null	Het
Rcc1	A	G	4: 132,334,116	S361P	probably benign	Het
Rnf213	A	G	11: 119,459,966	I3876V	probably benign	Het
Sall2	T	A	14: 52,313,593	Q715L	probably damaging	Het
Sall2	G	A	14: 52,313,594	Q713*	probably null	Het
Sin3a	A	G	9: 57,113,701	S1004G	possibly damaging	Het
Sltm	C	T	9: 70,542,987	T23M	probably damaging	Het
Sspo	A	G	6: 48,451,806	E385G	probably benign	Het
Syne3	G	T	12: 104,940,704	R775S	possibly damaging	Het
Szt2	A	T	4: 118,376,697		probably benign	Het
Tlk2	T	C	11: 105,221,273	S151P	probably benign	Het
Trabd2b	C	T	4: 114,586,560	R305C	probably damaging	Het
Ttc21b	T	C	2: 66,188,331	Q1244R	probably damaging	Het
Vmn2r125	A	G	4: 156,351,062	N245S	probably benign	Het
Wdr34	T	C	2: 30,032,767	S323G	probably benign	Het
Wdr64	G	A	1: 175,785,609		probably null	Het
Wdr70	G	A	15: 7,885,637	T550M	possibly damaging	Het
Wdr78	A	C	4: 103,049,549	M689R	probably benign	Het

Other mutations in Cd180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cd180	APN	13	102705409	missense	probably benign
IGL00949:Cd180	APN	13	102693760	missense	possibly damaging	0.89
IGL01864:Cd180	APN	13	102706033	missense	possibly damaging	0.93
IGL01901:Cd180	APN	13	102706428	missense	probably benign	0.04
IGL01934:Cd180	APN	13	102702858	missense	probably damaging	1.00
IGL01998:Cd180	APN	13	102705214	missense	probably damaging	0.99
IGL02336:Cd180	APN	13	102705313	missense	probably damaging	0.98
IGL03031:Cd180	APN	13	102705027	missense	probably benign	0.00
IGL03139:Cd180	APN	13	102706416	missense	probably damaging	1.00
Volte_face	UTSW	13	102704923	missense	probably damaging	0.99
H8562:Cd180	UTSW	13	102705418	missense	probably benign	0.02
R0004:Cd180	UTSW	13	102702708	missense	probably benign	0.00
R0393:Cd180	UTSW	13	102705900	missense	probably damaging	0.99
R0565:Cd180	UTSW	13	102702874	intron	probably benign
R1080:Cd180	UTSW	13	102706220	nonsense	probably null
R1223:Cd180	UTSW	13	102706222	missense	possibly damaging	0.49
R1669:Cd180	UTSW	13	102705490	missense	probably damaging	1.00
R1772:Cd180	UTSW	13	102706242	missense	probably benign	0.11
R1784:Cd180	UTSW	13	102705859	missense	probably damaging	1.00
R1865:Cd180	UTSW	13	102706009	missense	probably benign
R2252:Cd180	UTSW	13	102706398	nonsense	probably null
R2385:Cd180	UTSW	13	102705183	missense	probably benign	0.00
R4653:Cd180	UTSW	13	102704908	missense	probably damaging	1.00
R4695:Cd180	UTSW	13	102705760	missense	probably benign	0.01
R4790:Cd180	UTSW	13	102702822	missense	probably damaging	0.98
R4934:Cd180	UTSW	13	102739164	critical splice acceptor site	probably null
R5052:Cd180	UTSW	13	102704895	missense	probably benign
R5154:Cd180	UTSW	13	102705774	missense	probably damaging	1.00
R5469:Cd180	UTSW	13	102704834	missense	probably benign	0.37
R5493:Cd180	UTSW	13	102706141	missense	probably benign	0.07
R5615:Cd180	UTSW	13	102706203	missense	probably benign	0.34
R5905:Cd180	UTSW	13	102706033	missense	possibly damaging	0.93
R6282:Cd180	UTSW	13	102693757	missense	possibly damaging	0.90
R6433:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R6784:Cd180	UTSW	13	102702705	missense	probably damaging	0.97
R6815:Cd180	UTSW	13	102705429	missense	probably damaging	1.00
R6838:Cd180	UTSW	13	102702731	missense	probably benign	0.38
R6941:Cd180	UTSW	13	102706191	missense	probably benign	0.23
R7048:Cd180	UTSW	13	102704923	missense	probably damaging	0.99
R7338:Cd180	UTSW	13	102706428	missense	probably benign	0.04
R7466:Cd180	UTSW	13	102704995	missense	probably damaging	1.00
R7647:Cd180	UTSW	13	102705943	missense	probably damaging	1.00
R8179:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R8252:Cd180	UTSW	13	102705996	missense	probably benign	0.00
R8300:Cd180	UTSW	13	102704793	missense	probably benign	0.01
R8460:Cd180	UTSW	13	102702846	missense	probably damaging	1.00
Z1176:Cd180	UTSW	13	102705766	missense	probably damaging	1.00
Z1177:Cd180	UTSW	13	102706032	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GAGTGAATCAAACTACTGAATCCAG -3'
(R):5'- CTCTACTAAGGCAGAGCTAGAGAACAG -3'

Sequencing Primer
(F):5'- CTGGCACTTTACCAAACTC -3'
(R):5'- AATAGCACTCGGAATGCATTTC -3'

Posted On

2018-06-06