Incidental Mutation 'R6533:Btn2a2'
ID520221
Institutional Source Beutler Lab
Gene Symbol Btn2a2
Ensembl Gene ENSMUSG00000053216
Gene Namebutyrophilin, subfamily 2, member A2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6533 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23477676-23488857 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 23481781 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 294 (E294*)
Ref Sequence ENSEMBL: ENSMUSP00000153680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041541] [ENSMUST00000110432] [ENSMUST00000110433] [ENSMUST00000223877]
Predicted Effect probably null
Transcript: ENSMUST00000041541
AA Change: E294*
SMART Domains Protein: ENSMUSP00000048251
Gene: ENSMUSG00000053216
AA Change: E294*

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 3.3e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110432
AA Change: E294*
SMART Domains Protein: ENSMUSP00000106062
Gene: ENSMUSG00000053216
AA Change: E294*

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Blast:IG_like 151 211 1e-29 BLAST
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110433
AA Change: E294*
SMART Domains Protein: ENSMUSP00000106063
Gene: ENSMUSG00000053216
AA Change: E294*

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 37 144 9.12e-7 SMART
Pfam:C2-set_2 148 231 1.2e-8 PFAM
transmembrane domain 250 272 N/A INTRINSIC
coiled coil region 276 304 N/A INTRINSIC
PRY 312 364 1.87e-27 SMART
SPRY 365 485 3.56e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000223877
AA Change: E294*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Butyrophilin is the major protein associated with fat droplets in the milk. This gene is a member of the BTN2 subfamily of genes, which encode proteins belonging to the butyrophilin protein family. The gene is located in a cluster on chromosome 6, consisting of seven genes belonging to the expanding B7/butyrophilin-like group, a subset of the immunoglobulin gene superfamily. The encoded protein is a type I receptor glycoprotein involved in lipid, fatty-acid and sterol metabolism. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,835 probably benign Het
4932414N04Rik G T 2: 68,716,318 E115* probably null Het
Abhd16a G A 17: 35,098,809 probably null Het
Ankrd28 T A 14: 31,732,084 I244L possibly damaging Het
Barx2 T C 9: 31,912,979 Y38C probably damaging Het
Ceacam2 C G 7: 25,530,711 V157L probably benign Het
Ces2c T A 8: 104,852,093 F334L possibly damaging Het
Col7a1 T C 9: 108,961,358 I958T unknown Het
Cyhr1 C A 15: 76,647,730 E283* probably null Het
Dcp2 T A 18: 44,399,664 D82E probably benign Het
Dnah8 T C 17: 30,746,990 L2432S probably damaging Het
Dst A G 1: 34,303,509 D7582G probably benign Het
Fat3 T A 9: 15,998,899 I1936L probably benign Het
Gsdmc4 T A 15: 63,892,060 N396I probably damaging Het
Lonrf2 A C 1: 38,813,268 D167E probably benign Het
Marf1 T C 16: 14,115,799 D1575G probably benign Het
Med23 T C 10: 24,893,620 L101P probably damaging Het
Myh3 A G 11: 67,090,419 I703V probably damaging Het
Ncan G A 8: 70,096,357 A1257V probably benign Het
Nipal4 A T 11: 46,150,407 Y320* probably null Het
Obox5 A T 7: 15,757,607 Q24L probably benign Het
Orc1 T C 4: 108,597,447 S345P probably benign Het
P4hb A T 11: 120,571,643 I79N probably damaging Het
Phf3 A T 1: 30,806,318 I1262N probably damaging Het
Pigo A T 4: 43,022,697 N291K probably benign Het
Ppargc1b C T 18: 61,307,774 R691H possibly damaging Het
Ppm1m T C 9: 106,196,870 probably benign Het
Ptprd A T 4: 76,128,528 D500E probably damaging Het
Rab3gap2 T A 1: 185,232,954 probably null Het
Rnf214 A G 9: 45,900,063 S101P probably benign Het
Sdhc A G 1: 171,129,827 S162P possibly damaging Het
Spta1 C T 1: 174,244,147 T2231I probably damaging Het
Stxbp2 T A 8: 3,642,683 D578E probably benign Het
Tacc2 A T 7: 130,622,837 E417D possibly damaging Het
Tas2r144 A T 6: 42,215,346 N7Y probably benign Het
Tasp1 A G 2: 139,834,357 *421R probably null Het
Tigd5 A G 15: 75,910,190 I134V possibly damaging Het
Tmem95 A T 11: 69,878,017 M1K probably null Het
Trappc10 T C 10: 78,188,894 M1134V probably damaging Het
Unc45a T G 7: 80,334,069 K326N probably damaging Het
Vmn1r59 A G 7: 5,454,464 V99A probably benign Het
Vmn2r4 T C 3: 64,415,098 T67A probably benign Het
Vmn2r85 A T 10: 130,426,660 M70K probably benign Het
Zkscan8 A G 13: 21,520,578 F325S probably damaging Het
Other mutations in Btn2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Btn2a2 APN 13 23478576 missense probably damaging 1.00
IGL00740:Btn2a2 APN 13 23478485 missense probably benign
IGL02053:Btn2a2 APN 13 23478820 missense probably damaging 1.00
IGL02720:Btn2a2 APN 13 23480467 missense probably benign 0.15
IGL02738:Btn2a2 APN 13 23478806 nonsense probably null
IGL03010:Btn2a2 APN 13 23486205 nonsense probably null
IGL03221:Btn2a2 APN 13 23478449 missense probably damaging 1.00
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0066:Btn2a2 UTSW 13 23478485 missense probably benign 0.01
R0597:Btn2a2 UTSW 13 23486410 missense probably benign 0.12
R0749:Btn2a2 UTSW 13 23478398 makesense probably null
R1209:Btn2a2 UTSW 13 23480566 critical splice donor site probably null
R1283:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R1718:Btn2a2 UTSW 13 23481936 missense probably benign 0.01
R2925:Btn2a2 UTSW 13 23481814 missense probably damaging 1.00
R3824:Btn2a2 UTSW 13 23480465 missense probably benign 0.02
R5281:Btn2a2 UTSW 13 23478832 missense probably damaging 0.98
R5356:Btn2a2 UTSW 13 23482875 missense probably benign 0.02
R5482:Btn2a2 UTSW 13 23486387 missense probably benign 0.03
R5535:Btn2a2 UTSW 13 23478275 missense probably benign 0.14
R5629:Btn2a2 UTSW 13 23481960 splice site probably null
R5930:Btn2a2 UTSW 13 23486228 missense probably damaging 0.96
R5952:Btn2a2 UTSW 13 23482808 missense probably benign 0.09
R6006:Btn2a2 UTSW 13 23486363 missense probably damaging 1.00
R6196:Btn2a2 UTSW 13 23487845 missense possibly damaging 0.74
R6373:Btn2a2 UTSW 13 23481829 missense probably benign 0.00
R6891:Btn2a2 UTSW 13 23482844 missense probably benign 0.10
R7468:Btn2a2 UTSW 13 23482763 missense probably benign 0.39
R7814:Btn2a2 UTSW 13 23482806 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GCACTTCTGCTGCACCTATG -3'
(R):5'- GTTCCAGAATCCTTCGTGCC -3'

Sequencing Primer
(F):5'- ATGTGTCCTCTATCTAGTTCAGAGG -3'
(R):5'- AGAATCCTTCGTGCCCAGCC -3'
Posted On2018-06-06