Incidental Mutation 'R6533:Cyhr1'
ID520229
Institutional Source Beutler Lab
Gene Symbol Cyhr1
Ensembl Gene ENSMUSG00000053929
Gene Namecysteine and histidine rich 1
Synonyms1110031M01Rik, Chrp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R6533 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76643395-76660117 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 76647730 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 283 (E283*)
Ref Sequence ENSEMBL: ENSMUSP00000134739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081291] [ENSMUST00000176274] [ENSMUST00000229524]
Predicted Effect probably benign
Transcript: ENSMUST00000081291
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000176274
AA Change: E283*
SMART Domains Protein: ENSMUSP00000134739
Gene: ENSMUSG00000053929
AA Change: E283*

DomainStartEndE-ValueType
low complexity region 3 48 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
RING 106 150 1.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229552
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010B08Rik C T 2: 173,719,835 probably benign Het
4932414N04Rik G T 2: 68,716,318 E115* probably null Het
Abhd16a G A 17: 35,098,809 probably null Het
Ankrd28 T A 14: 31,732,084 I244L possibly damaging Het
Barx2 T C 9: 31,912,979 Y38C probably damaging Het
Btn2a2 C A 13: 23,481,781 E294* probably null Het
Ceacam2 C G 7: 25,530,711 V157L probably benign Het
Ces2c T A 8: 104,852,093 F334L possibly damaging Het
Col7a1 T C 9: 108,961,358 I958T unknown Het
Dcp2 T A 18: 44,399,664 D82E probably benign Het
Dnah8 T C 17: 30,746,990 L2432S probably damaging Het
Dst A G 1: 34,303,509 D7582G probably benign Het
Fat3 T A 9: 15,998,899 I1936L probably benign Het
Gsdmc4 T A 15: 63,892,060 N396I probably damaging Het
Lonrf2 A C 1: 38,813,268 D167E probably benign Het
Marf1 T C 16: 14,115,799 D1575G probably benign Het
Med23 T C 10: 24,893,620 L101P probably damaging Het
Myh3 A G 11: 67,090,419 I703V probably damaging Het
Ncan G A 8: 70,096,357 A1257V probably benign Het
Nipal4 A T 11: 46,150,407 Y320* probably null Het
Obox5 A T 7: 15,757,607 Q24L probably benign Het
Orc1 T C 4: 108,597,447 S345P probably benign Het
P4hb A T 11: 120,571,643 I79N probably damaging Het
Phf3 A T 1: 30,806,318 I1262N probably damaging Het
Pigo A T 4: 43,022,697 N291K probably benign Het
Ppargc1b C T 18: 61,307,774 R691H possibly damaging Het
Ppm1m T C 9: 106,196,870 probably benign Het
Ptprd A T 4: 76,128,528 D500E probably damaging Het
Rab3gap2 T A 1: 185,232,954 probably null Het
Rnf214 A G 9: 45,900,063 S101P probably benign Het
Sdhc A G 1: 171,129,827 S162P possibly damaging Het
Spta1 C T 1: 174,244,147 T2231I probably damaging Het
Stxbp2 T A 8: 3,642,683 D578E probably benign Het
Tacc2 A T 7: 130,622,837 E417D possibly damaging Het
Tas2r144 A T 6: 42,215,346 N7Y probably benign Het
Tasp1 A G 2: 139,834,357 *421R probably null Het
Tigd5 A G 15: 75,910,190 I134V possibly damaging Het
Tmem95 A T 11: 69,878,017 M1K probably null Het
Trappc10 T C 10: 78,188,894 M1134V probably damaging Het
Unc45a T G 7: 80,334,069 K326N probably damaging Het
Vmn1r59 A G 7: 5,454,464 V99A probably benign Het
Vmn2r4 T C 3: 64,415,098 T67A probably benign Het
Vmn2r85 A T 10: 130,426,660 M70K probably benign Het
Zkscan8 A G 13: 21,520,578 F325S probably damaging Het
Other mutations in Cyhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Cyhr1 APN 15 76646538 missense probably damaging 1.00
IGL03163:Cyhr1 APN 15 76659274 missense probably damaging 0.97
R0107:Cyhr1 UTSW 15 76646347 missense possibly damaging 0.90
R0445:Cyhr1 UTSW 15 76648257 missense probably damaging 1.00
R0759:Cyhr1 UTSW 15 76646185 makesense probably null
R1327:Cyhr1 UTSW 15 76649176 missense probably damaging 0.98
R1366:Cyhr1 UTSW 15 76648969 missense probably damaging 0.96
R1950:Cyhr1 UTSW 15 76659217 critical splice donor site probably null
R3416:Cyhr1 UTSW 15 76658715 splice site probably null
R5092:Cyhr1 UTSW 15 76646312 missense probably benign 0.11
R5749:Cyhr1 UTSW 15 76658644 splice site probably null
R5860:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R5860:Cyhr1 UTSW 15 76656415 missense probably damaging 1.00
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6032:Cyhr1 UTSW 15 76658858 missense probably damaging 0.99
R6397:Cyhr1 UTSW 15 76648191 missense probably damaging 1.00
R6481:Cyhr1 UTSW 15 76658708 splice site probably null
R7466:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7484:Cyhr1 UTSW 15 76646235 missense probably damaging 1.00
R7629:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7732:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
R7763:Cyhr1 UTSW 15 76658547 missense probably damaging 0.99
R7861:Cyhr1 UTSW 15 76648186 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACATGTTCAGAGCTGGTGAC -3'
(R):5'- GCATGGCTCCTATAAATGTCCTTC -3'

Sequencing Primer
(F):5'- ATGAGATCCAGTGGGCCTG -3'
(R):5'- GGCTCCTATAAATGTCCTTCCCACC -3'
Posted On2018-06-06