Incidental Mutation 'R6469:Phlpp1'
ID520235
Institutional Source Beutler Lab
Gene Symbol Phlpp1
Ensembl Gene ENSMUSG00000044340
Gene NamePH domain and leucine rich repeat protein phosphatase 1
SynonymsPhlpp, Plekhe1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R6469 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location106171752-106394250 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106287103 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 585 (R585Q)
Ref Sequence ENSEMBL: ENSMUSP00000056530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061047]
Predicted Effect probably damaging
Transcript: ENSMUST00000061047
AA Change: R585Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000056530
Gene: ENSMUSG00000044340
AA Change: R585Q

DomainStartEndE-ValueType
low complexity region 3 9 N/A INTRINSIC
low complexity region 21 27 N/A INTRINSIC
low complexity region 35 96 N/A INTRINSIC
low complexity region 97 143 N/A INTRINSIC
low complexity region 152 163 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 227 235 N/A INTRINSIC
low complexity region 257 277 N/A INTRINSIC
low complexity region 299 313 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 355 369 N/A INTRINSIC
PH 493 594 3.16e-2 SMART
LRR 615 634 4.75e2 SMART
LRR 648 669 7.16e0 SMART
LRR 669 688 1.48e1 SMART
LRR 692 714 2.14e1 SMART
LRR 715 738 1.37e1 SMART
LRR 786 809 3.27e1 SMART
LRR 849 868 8.11e0 SMART
LRR 872 895 1.97e1 SMART
LRR 895 914 2.55e1 SMART
LRR 919 940 1.86e1 SMART
LRR 941 960 1.67e1 SMART
LRR 991 1010 2.13e1 SMART
LRR 1015 1038 5.11e0 SMART
PP2Cc 1121 1376 2.62e-58 SMART
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1424 1445 N/A INTRINSIC
Blast:PP2Cc 1463 1555 2e-39 BLAST
low complexity region 1608 1624 N/A INTRINSIC
low complexity region 1640 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135810
Meta Mutation Damage Score 0.3828 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine phosphatase family. The encoded protein promotes apoptosis by dephosphorylating and inactivating the serine/threonine kinase Akt, and functions as a tumor suppressor in multiple types of cancer. Increased expression of this gene may also play a role in obesity and type 2 diabetes by interfering with Akt-mediated insulin signaling. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null mutation display impairment in the ability to stabilize the circadian period after light induced resetting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T G 3: 138,066,975 S642A probably damaging Het
Aadacl2 A T 3: 60,024,789 T242S probably benign Het
Adprh T C 16: 38,450,309 M45V probably benign Het
Akr1c13 T C 13: 4,196,512 probably null Het
Ap3d1 A C 10: 80,712,158 V900G probably benign Het
Bak1 G A 17: 27,021,319 R125C probably damaging Het
Bmpr1b T C 3: 141,856,461 T322A possibly damaging Het
Camsap3 T A 8: 3,603,941 L521Q possibly damaging Het
Col6a6 A T 9: 105,698,691 F2157I probably damaging Het
Dcun1d4 G A 5: 73,534,614 M155I probably damaging Het
Diaph3 T C 14: 86,656,538 S12G possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgb A T 3: 83,046,142 L107* probably null Het
Ganab T C 19: 8,902,632 probably null Het
Gba C T 3: 89,204,081 P51L probably benign Het
Glb1l2 T C 9: 26,796,532 D60G probably benign Het
Gm20767 T A 13: 120,154,813 W63R probably damaging Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Itih2 A G 2: 10,123,413 V159A possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lrch1 C T 14: 74,817,085 R323Q probably damaging Het
Lrrc30 T C 17: 67,631,865 N240S probably benign Het
Mrgpra9 T C 7: 47,235,106 Y271C probably benign Het
Ncor1 T C 11: 62,343,302 H682R probably damaging Het
Olfr115 A T 17: 37,610,313 V146E probably damaging Het
Pax9 C A 12: 56,696,863 F98L probably damaging Het
Prkdc A G 16: 15,795,075 T3166A probably benign Het
Prr11 T A 11: 87,097,177 Q300L possibly damaging Het
Rad50 T A 11: 53,684,235 E620D probably benign Het
Rpl3 A T 15: 80,083,345 probably null Het
Sacs G T 14: 61,191,248 G252V probably damaging Het
Serpina3i T A 12: 104,266,517 V227E probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snx19 T C 9: 30,427,743 V59A possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tsc1 G A 2: 28,671,886 probably null Het
Vmn2r61 C T 7: 42,265,859 Q77* probably null Het
Wdr72 A G 9: 74,213,361 H954R probably benign Het
Zbtb21 T C 16: 97,956,772 M20V probably benign Het
Zkscan16 A T 4: 58,956,483 D255V probably damaging Het
Other mutations in Phlpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Phlpp1 APN 1 106376255 missense probably damaging 1.00
IGL00848:Phlpp1 APN 1 106339448 missense probably damaging 1.00
IGL01122:Phlpp1 APN 1 106173436 missense possibly damaging 0.51
IGL01588:Phlpp1 APN 1 106380389 missense probably damaging 1.00
IGL02145:Phlpp1 APN 1 106389883 missense probably damaging 0.96
IGL02417:Phlpp1 APN 1 106392714 missense probably benign 0.00
IGL02863:Phlpp1 APN 1 106376297 splice site probably null
IGL03178:Phlpp1 APN 1 106392388 missense probably damaging 0.99
R0400:Phlpp1 UTSW 1 106392934 missense probably benign 0.35
R0423:Phlpp1 UTSW 1 106339615 missense probably benign 0.03
R0449:Phlpp1 UTSW 1 106350578 missense probably damaging 0.98
R0765:Phlpp1 UTSW 1 106392283 missense probably damaging 1.00
R0884:Phlpp1 UTSW 1 106389665 splice site probably null
R1394:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1395:Phlpp1 UTSW 1 106350618 missense possibly damaging 0.82
R1428:Phlpp1 UTSW 1 106380425 splice site probably null
R1438:Phlpp1 UTSW 1 106173412 missense possibly damaging 0.53
R1521:Phlpp1 UTSW 1 106392319 missense probably damaging 1.00
R1572:Phlpp1 UTSW 1 106392789 missense probably damaging 1.00
R1588:Phlpp1 UTSW 1 106380385 missense probably damaging 1.00
R1843:Phlpp1 UTSW 1 106343505 missense probably benign 0.40
R1889:Phlpp1 UTSW 1 106318850 missense possibly damaging 0.95
R2404:Phlpp1 UTSW 1 106172839 missense probably benign 0.22
R2942:Phlpp1 UTSW 1 106172772 missense probably benign 0.00
R3774:Phlpp1 UTSW 1 106393191 small deletion probably benign
R3832:Phlpp1 UTSW 1 106392597 missense probably damaging 1.00
R4029:Phlpp1 UTSW 1 106392549 missense probably damaging 0.98
R4086:Phlpp1 UTSW 1 106347161 missense probably benign 0.03
R4112:Phlpp1 UTSW 1 106364338 missense probably damaging 1.00
R4472:Phlpp1 UTSW 1 106386446 missense probably damaging 1.00
R4654:Phlpp1 UTSW 1 106339501 missense probably benign 0.00
R4908:Phlpp1 UTSW 1 106389751 missense probably damaging 1.00
R5027:Phlpp1 UTSW 1 106281471 missense probably damaging 1.00
R5199:Phlpp1 UTSW 1 106173394 missense probably damaging 0.98
R5352:Phlpp1 UTSW 1 106172725 missense probably benign 0.07
R5508:Phlpp1 UTSW 1 106364390 missense probably benign 0.02
R5570:Phlpp1 UTSW 1 106173432 missense probably benign 0.01
R5590:Phlpp1 UTSW 1 106392927 missense possibly damaging 0.95
R5838:Phlpp1 UTSW 1 106347132 nonsense probably null
R5955:Phlpp1 UTSW 1 106364230 splice site probably null
R5992:Phlpp1 UTSW 1 106318993 nonsense probably null
R6821:Phlpp1 UTSW 1 106386444 missense probably damaging 0.98
R6952:Phlpp1 UTSW 1 106172479 missense probably benign 0.04
R7101:Phlpp1 UTSW 1 106172667 missense possibly damaging 0.96
R7402:Phlpp1 UTSW 1 106389690 missense probably damaging 1.00
R7425:Phlpp1 UTSW 1 106392573 missense probably benign 0.00
R7692:Phlpp1 UTSW 1 106281402 missense probably damaging 1.00
R7874:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
R7957:Phlpp1 UTSW 1 106389873 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCAAGAATGGCTGCAAGTTC -3'
(R):5'- TACTGACCTAAAACTGGTGGGAG -3'

Sequencing Primer
(F):5'- TGGCTGCAAGTTCTAAGAGG -3'
(R):5'- AAAACTGGTGGGAGGTGTTAATTTTC -3'
Posted On2018-06-06