Incidental Mutation 'R6469:Tsc1'
ID520239
Institutional Source Beutler Lab
Gene Symbol Tsc1
Ensembl Gene ENSMUSG00000026812
Gene Nametuberous sclerosis 1
Synonymshamartin
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_022887.3; MGI: 1929183

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6469 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location28641228-28691167 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 28671886 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028155] [ENSMUST00000113867] [ENSMUST00000113869] [ENSMUST00000113870] [ENSMUST00000133565] [ENSMUST00000156857]
Predicted Effect probably null
Transcript: ENSMUST00000028155
SMART Domains Protein: ENSMUSP00000028155
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113867
SMART Domains Protein: ENSMUSP00000109498
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 710 7.3e-279 PFAM
SCOP:d1eq1a_ 718 881 6e-11 SMART
low complexity region 969 985 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1094 1112 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113869
SMART Domains Protein: ENSMUSP00000109500
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 7 716 6e-279 PFAM
SCOP:d1eq1a_ 724 887 4e-11 SMART
low complexity region 975 991 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1100 1118 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000113870
SMART Domains Protein: ENSMUSP00000109501
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 715 2.2e-281 PFAM
SCOP:d1eq1a_ 723 886 4e-11 SMART
low complexity region 974 990 N/A INTRINSIC
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1099 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125715
Predicted Effect probably benign
Transcript: ENSMUST00000133565
SMART Domains Protein: ENSMUSP00000120888
Gene: ENSMUSG00000026812

DomainStartEndE-ValueType
Pfam:Hamartin 2 455 1.3e-198 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139642
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153625
Predicted Effect probably benign
Transcript: ENSMUST00000156857
AA Change: R345Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115380
Gene: ENSMUSG00000026812
AA Change: R345Q

DomainStartEndE-ValueType
Pfam:Hamartin 2 348 2.3e-170 PFAM
Meta Mutation Damage Score 0.9044 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.3%
Validation Efficiency 100% (43/43)
MGI Phenotype Strain: 2183900
Lethality: E10-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a growth inhibitory protein thought to play a role in the stabilization of tuberin. Mutations in this gene have been associated with tuberous sclerosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygous null mutants show liver hypoplasia, open neural tube and die by embryonic day 10.5-11.5. Heterozygotes develop kidney cystadenomas and liver hemangiomas. Conditional astrocyte-specific nulls show increased astrocyte numbers and seizures. [provided by MGI curators]
Allele List at MGI

All alleles(38) : Targeted(7) Gene trapped(31)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T G 3: 138,066,975 S642A probably damaging Het
Aadacl2 A T 3: 60,024,789 T242S probably benign Het
Adprh T C 16: 38,450,309 M45V probably benign Het
Akr1c13 T C 13: 4,196,512 probably null Het
Ap3d1 A C 10: 80,712,158 V900G probably benign Het
Bak1 G A 17: 27,021,319 R125C probably damaging Het
Bmpr1b T C 3: 141,856,461 T322A possibly damaging Het
Camsap3 T A 8: 3,603,941 L521Q possibly damaging Het
Col6a6 A T 9: 105,698,691 F2157I probably damaging Het
Dcun1d4 G A 5: 73,534,614 M155I probably damaging Het
Diaph3 T C 14: 86,656,538 S12G possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgb A T 3: 83,046,142 L107* probably null Het
Ganab T C 19: 8,902,632 probably null Het
Gba C T 3: 89,204,081 P51L probably benign Het
Glb1l2 T C 9: 26,796,532 D60G probably benign Het
Gm20767 T A 13: 120,154,813 W63R probably damaging Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Itih2 A G 2: 10,123,413 V159A possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lrch1 C T 14: 74,817,085 R323Q probably damaging Het
Lrrc30 T C 17: 67,631,865 N240S probably benign Het
Mrgpra9 T C 7: 47,235,106 Y271C probably benign Het
Ncor1 T C 11: 62,343,302 H682R probably damaging Het
Olfr115 A T 17: 37,610,313 V146E probably damaging Het
Pax9 C A 12: 56,696,863 F98L probably damaging Het
Phlpp1 G A 1: 106,287,103 R585Q probably damaging Het
Prkdc A G 16: 15,795,075 T3166A probably benign Het
Prr11 T A 11: 87,097,177 Q300L possibly damaging Het
Rad50 T A 11: 53,684,235 E620D probably benign Het
Rpl3 A T 15: 80,083,345 probably null Het
Sacs G T 14: 61,191,248 G252V probably damaging Het
Serpina3i T A 12: 104,266,517 V227E probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snx19 T C 9: 30,427,743 V59A possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Vmn2r61 C T 7: 42,265,859 Q77* probably null Het
Wdr72 A G 9: 74,213,361 H954R probably benign Het
Zbtb21 T C 16: 97,956,772 M20V probably benign Het
Zkscan16 A T 4: 58,956,483 D255V probably damaging Het
Other mutations in Tsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tsc1 APN 2 28661611 missense probably damaging 0.98
IGL00770:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00774:Tsc1 APN 2 28665011 missense probably damaging 1.00
IGL00835:Tsc1 APN 2 28672466 missense possibly damaging 0.93
IGL00971:Tsc1 APN 2 28670940 nonsense probably null
IGL01808:Tsc1 APN 2 28662507 missense probably damaging 1.00
IGL02281:Tsc1 APN 2 28663595 missense probably damaging 1.00
IGL03068:Tsc1 APN 2 28681258 missense probably damaging 1.00
Cassava UTSW 2 28671886 splice site probably null
R0077:Tsc1 UTSW 2 28678943 splice site probably benign
R0149:Tsc1 UTSW 2 28670901 missense probably damaging 0.99
R0605:Tsc1 UTSW 2 28671778 missense probably damaging 1.00
R0737:Tsc1 UTSW 2 28670930 missense possibly damaging 0.94
R1199:Tsc1 UTSW 2 28665626 missense probably damaging 1.00
R1751:Tsc1 UTSW 2 28676026 missense probably damaging 0.97
R1757:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R1807:Tsc1 UTSW 2 28686113 missense probably benign 0.05
R2014:Tsc1 UTSW 2 28665637 splice site probably benign
R2284:Tsc1 UTSW 2 28665097 missense possibly damaging 0.85
R3786:Tsc1 UTSW 2 28687142 missense probably damaging 1.00
R4490:Tsc1 UTSW 2 28670925 missense probably damaging 0.97
R4707:Tsc1 UTSW 2 28672407 missense probably damaging 1.00
R4751:Tsc1 UTSW 2 28679081 missense probably damaging 0.96
R4794:Tsc1 UTSW 2 28661690 splice site probably null
R4906:Tsc1 UTSW 2 28675189 missense possibly damaging 0.81
R5020:Tsc1 UTSW 2 28676519 missense probably damaging 1.00
R5401:Tsc1 UTSW 2 28686908 nonsense probably null
R5708:Tsc1 UTSW 2 28665185 intron probably benign
R6435:Tsc1 UTSW 2 28676452 missense probably benign 0.08
R6502:Tsc1 UTSW 2 28665601 missense probably damaging 1.00
R6617:Tsc1 UTSW 2 28686989 missense possibly damaging 0.82
R7098:Tsc1 UTSW 2 28675732 missense probably benign 0.00
R7503:Tsc1 UTSW 2 28687076 missense possibly damaging 0.50
R7608:Tsc1 UTSW 2 28658736 missense probably benign 0.01
R7677:Tsc1 UTSW 2 28672817 missense probably benign 0.11
R7791:Tsc1 UTSW 2 28681948 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGATGGTCTAGAGGACTGTG -3'
(R):5'- ACAAGTTGCATTTCAGGTGTCTG -3'

Sequencing Primer
(F):5'- GATTGTTTATCACAGTGACCTGGCAC -3'
(R):5'- TCAGGTGTCTGGGCTCCAAG -3'
Posted On2018-06-06