Mutagenetix > Incidental Mutations

Incidental Mutation 'R6469:1110002E22Rik'

520248

Institutional Source

Beutler Lab

Gene Symbol

1110002E22Rik

Ensembl Gene

ENSMUSG00000090066

Gene Name

RIKEN cDNA 1110002E22 gene

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.519) question?

Stock #

R6469 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

138065052-138081506 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 138066975 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 642 (S642A)

Ref Sequence

ENSEMBL: ENSMUSP00000123851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053318] [ENSMUST00000163080]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000053318

Predicted Effect

probably damaging
Transcript: ENSMUST00000163080
AA Change: S642A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: S642A

Domain	Start	End	E-Value	Type
low complexity region	44	55	N/A	INTRINSIC
low complexity region	87	102	N/A	INTRINSIC
low complexity region	229	247	N/A	INTRINSIC
low complexity region	422	438	N/A	INTRINSIC
low complexity region	459	505	N/A	INTRINSIC
low complexity region	667	680	N/A	INTRINSIC
low complexity region	937	948	N/A	INTRINSIC
low complexity region	995	1007	N/A	INTRINSIC
low complexity region	1105	1115	N/A	INTRINSIC
low complexity region	1224	1242	N/A	INTRINSIC
low complexity region	1376	1385	N/A	INTRINSIC
Pfam:DUF4585	1598	1667	6.9e-32	PFAM
low complexity region	1723	1738	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184925

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.3%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl2	A	T	3: 60,024,789	T242S	probably benign	Het
Adprh	T	C	16: 38,450,309	M45V	probably benign	Het
Akr1c13	T	C	13: 4,196,512		probably null	Het
Ap3d1	A	C	10: 80,712,158	V900G	probably benign	Het
Bak1	G	A	17: 27,021,319	R125C	probably damaging	Het
Bmpr1b	T	C	3: 141,856,461	T322A	possibly damaging	Het
Camsap3	T	A	8: 3,603,941	L521Q	possibly damaging	Het
Col6a6	A	T	9: 105,698,691	F2157I	probably damaging	Het
Dcun1d4	G	A	5: 73,534,614	M155I	probably damaging	Het
Diaph3	T	C	14: 86,656,538	S12G	possibly damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fgb	A	T	3: 83,046,142	L107*	probably null	Het
Ganab	T	C	19: 8,902,632		probably null	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Glb1l2	T	C	9: 26,796,532	D60G	probably benign	Het
Gm20767	T	A	13: 120,154,813	W63R	probably damaging	Het
Idh3b	AG	AGCACCACAACTG	2: 130,279,673		probably null	Het
Itih2	A	G	2: 10,123,413	V159A	possibly damaging	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Lrch1	C	T	14: 74,817,085	R323Q	probably damaging	Het
Lrrc30	T	C	17: 67,631,865	N240S	probably benign	Het
Mrgpra9	T	C	7: 47,235,106	Y271C	probably benign	Het
Ncor1	T	C	11: 62,343,302	H682R	probably damaging	Het
Olfr115	A	T	17: 37,610,313	V146E	probably damaging	Het
Pax9	C	A	12: 56,696,863	F98L	probably damaging	Het
Phlpp1	G	A	1: 106,287,103	R585Q	probably damaging	Het
Prkdc	A	G	16: 15,795,075	T3166A	probably benign	Het
Prr11	T	A	11: 87,097,177	Q300L	possibly damaging	Het
Rad50	T	A	11: 53,684,235	E620D	probably benign	Het
Rpl3	A	T	15: 80,083,345		probably null	Het
Sacs	G	T	14: 61,191,248	G252V	probably damaging	Het
Serpina3i	T	A	12: 104,266,517	V227E	probably damaging	Het
Smap2	GACTCTAC	GAC	4: 120,973,085		probably benign	Het
Snx19	T	C	9: 30,427,743	V59A	possibly damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tsc1	G	A	2: 28,671,886		probably null	Het
Vmn2r61	C	T	7: 42,265,859	Q77*	probably null	Het
Wdr72	A	G	9: 74,213,361	H954R	probably benign	Het
Zbtb21	T	C	16: 97,956,772	M20V	probably benign	Het
Zkscan16	A	T	4: 58,956,483	D255V	probably damaging	Het

Other mutations in 1110002E22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0026:1110002E22Rik	UTSW	3	138066805	missense	possibly damaging	0.95
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0047:1110002E22Rik	UTSW	3	138066264	missense	probably damaging	0.97
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0102:1110002E22Rik	UTSW	3	138068113	missense	probably damaging	1.00
R0197:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0239:1110002E22Rik	UTSW	3	138065834	small deletion	probably benign
R0394:1110002E22Rik	UTSW	3	138067304	missense	probably damaging	0.99
R0401:1110002E22Rik	UTSW	3	138070306	missense	possibly damaging	0.73
R0496:1110002E22Rik	UTSW	3	138068244	missense	probably damaging	1.00
R0591:1110002E22Rik	UTSW	3	138068943	nonsense	probably null
R0711:1110002E22Rik	UTSW	3	138068225	missense	probably damaging	0.99
R0883:1110002E22Rik	UTSW	3	138069871	missense	probably damaging	1.00
R0908:1110002E22Rik	UTSW	3	138070077	missense	probably damaging	0.99
R0968:1110002E22Rik	UTSW	3	138067206	missense	probably damaging	0.99
R1023:1110002E22Rik	UTSW	3	138066871	missense	probably damaging	1.00
R1168:1110002E22Rik	UTSW	3	138067900	missense	probably benign	0.20
R1472:1110002E22Rik	UTSW	3	138067552	missense	possibly damaging	0.95
R1538:1110002E22Rik	UTSW	3	138065401	missense	probably benign	0.02
R1648:1110002E22Rik	UTSW	3	138069420	missense	probably benign	0.18
R1800:1110002E22Rik	UTSW	3	138066718	missense	probably damaging	1.00
R1919:1110002E22Rik	UTSW	3	138067270	missense	probably damaging	0.99
R1974:1110002E22Rik	UTSW	3	138067267	missense	probably damaging	1.00
R1990:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R1991:1110002E22Rik	UTSW	3	138065658	nonsense	probably null
R2102:1110002E22Rik	UTSW	3	138065173	missense	probably damaging	0.99
R2761:1110002E22Rik	UTSW	3	138067780	missense	probably damaging	0.99
R2899:1110002E22Rik	UTSW	3	138065682	missense	probably benign	0.00
R3618:1110002E22Rik	UTSW	3	138068407	missense	probably damaging	1.00
R3904:1110002E22Rik	UTSW	3	138066639	missense	probably benign	0.15
R3955:1110002E22Rik	UTSW	3	138068073	missense	probably benign	0.00
R4520:1110002E22Rik	UTSW	3	138070266	missense	probably damaging	0.99
R4619:1110002E22Rik	UTSW	3	138069759	missense	probably damaging	0.99
R4736:1110002E22Rik	UTSW	3	138068485	missense	probably damaging	0.99
R4752:1110002E22Rik	UTSW	3	138069990	missense	possibly damaging	0.91
R4777:1110002E22Rik	UTSW	3	138065742	missense	probably benign	0.09
R4780:1110002E22Rik	UTSW	3	138065370	missense	probably benign	0.02
R4824:1110002E22Rik	UTSW	3	138065676	missense	probably benign	0.00
R4829:1110002E22Rik	UTSW	3	138069019	missense	probably damaging	0.99
R4965:1110002E22Rik	UTSW	3	138069672	missense	probably benign
R5206:1110002E22Rik	UTSW	3	138066511	missense	probably benign	0.00
R5212:1110002E22Rik	UTSW	3	138065850	missense	possibly damaging	0.85
R5373:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5374:1110002E22Rik	UTSW	3	138067635	missense	probably benign
R5506:1110002E22Rik	UTSW	3	138067947	missense	probably damaging	1.00
R5528:1110002E22Rik	UTSW	3	138066499	missense	probably benign
R5536:1110002E22Rik	UTSW	3	138066388	missense	possibly damaging	0.89
R5587:1110002E22Rik	UTSW	3	138065409	missense	probably benign
R5759:1110002E22Rik	UTSW	3	138068658	missense	probably benign
R5933:1110002E22Rik	UTSW	3	138070348	missense	probably damaging	1.00
R5957:1110002E22Rik	UTSW	3	138070161	missense	probably benign
R6092:1110002E22Rik	UTSW	3	138068940	missense	probably benign	0.02
R6305:1110002E22Rik	UTSW	3	138067980	missense	probably damaging	1.00
R6457:1110002E22Rik	UTSW	3	138066622	missense	probably damaging	1.00
R6499:1110002E22Rik	UTSW	3	138068800	missense	probably damaging	1.00
R6527:1110002E22Rik	UTSW	3	138067527	missense	probably damaging	0.99
R6580:1110002E22Rik	UTSW	3	138066625	missense	probably benign	0.00
R6693:1110002E22Rik	UTSW	3	138069154	missense	probably benign	0.00
R6751:1110002E22Rik	UTSW	3	138066210	missense	probably damaging	1.00
R6852:1110002E22Rik	UTSW	3	138065169	nonsense	probably null
R6920:1110002E22Rik	UTSW	3	138068050	missense	probably damaging	1.00
R7001:1110002E22Rik	UTSW	3	138065511	missense	probably benign
R7145:1110002E22Rik	UTSW	3	138070059	missense	probably damaging	1.00
R7238:1110002E22Rik	UTSW	3	138069951	missense	probably damaging	1.00
R7278:1110002E22Rik	UTSW	3	138065476	missense	probably benign
R7425:1110002E22Rik	UTSW	3	138065695	missense	probably benign	0.00
R7487:1110002E22Rik	UTSW	3	138066868	missense	probably damaging	1.00
R7557:1110002E22Rik	UTSW	3	138068283	nonsense	probably null
R7663:1110002E22Rik	UTSW	3	138066126	missense	probably damaging	0.98
R7743:1110002E22Rik	UTSW	3	138068755	missense	probably damaging	1.00
R7799:1110002E22Rik	UTSW	3	138069601	missense	probably benign	0.33
R8181:1110002E22Rik	UTSW	3	138068395	missense	probably damaging	0.99
R8264:1110002E22Rik	UTSW	3	138067782	missense	probably damaging	0.99
R8273:1110002E22Rik	UTSW	3	138066450	missense	probably benign
R8434:1110002E22Rik	UTSW	3	138067260	missense	probably damaging	0.97
R8530:1110002E22Rik	UTSW	3	138068825	missense	probably damaging	0.99
R8754:1110002E22Rik	UTSW	3	138066037	missense	probably benign
R8808:1110002E22Rik	UTSW	3	138070113	missense	probably benign	0.01
R8891:1110002E22Rik	UTSW	3	138066759	nonsense	probably null
R9026:1110002E22Rik	UTSW	3	138065148	missense	possibly damaging	0.53
R9177:1110002E22Rik	UTSW	3	138069916	missense	probably damaging	1.00
R9250:1110002E22Rik	UTSW	3	138066628	missense	probably damaging	1.00
R9291:1110002E22Rik	UTSW	3	138066703	missense	probably benign	0.02
R9293:1110002E22Rik	UTSW	3	138066078	missense	possibly damaging	0.93
R9307:1110002E22Rik	UTSW	3	138065422	missense	probably benign	0.04
R9439:1110002E22Rik	UTSW	3	138066287	missense	probably benign	0.00
X0003:1110002E22Rik	UTSW	3	138069096	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTCAGGACCATGCAAAG -3'
(R):5'- TTTGCTGACCACAAACTCCAAG -3'

Sequencing Primer
(F):5'- CAAAGAAATTCATTGCTGTCCCTGC -3'
(R):5'- AAGGCCTTGGTCTGCGACTTC -3'

Posted On

2018-06-06