Incidental Mutation 'R6469:Mrgpra9'
ID520260
Institutional Source Beutler Lab
Gene Symbol Mrgpra9
Ensembl Gene ENSMUSG00000074111
Gene NameMAS-related GPR, member A9
SynonymsEG668725, MrgA9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6469 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location47234861-47252848 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47235106 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 271 (Y271C)
Ref Sequence ENSEMBL: ENSMUSP00000136396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098436] [ENSMUST00000179005]
Predicted Effect probably benign
Transcript: ENSMUST00000098436
AA Change: Y270C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000096035
Gene: ENSMUSG00000074111
AA Change: Y270C

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Pfam:7tm_1 56 225 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179005
AA Change: Y271C

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136396
Gene: ENSMUSG00000074111
AA Change: Y271C

DomainStartEndE-ValueType
Pfam:7tm_1 12 178 3.4e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.3%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T G 3: 138,066,975 S642A probably damaging Het
Aadacl2 A T 3: 60,024,789 T242S probably benign Het
Adprh T C 16: 38,450,309 M45V probably benign Het
Akr1c13 T C 13: 4,196,512 probably null Het
Ap3d1 A C 10: 80,712,158 V900G probably benign Het
Bak1 G A 17: 27,021,319 R125C probably damaging Het
Bmpr1b T C 3: 141,856,461 T322A possibly damaging Het
Camsap3 T A 8: 3,603,941 L521Q possibly damaging Het
Col6a6 A T 9: 105,698,691 F2157I probably damaging Het
Dcun1d4 G A 5: 73,534,614 M155I probably damaging Het
Diaph3 T C 14: 86,656,538 S12G possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgb A T 3: 83,046,142 L107* probably null Het
Ganab T C 19: 8,902,632 probably null Het
Gba C T 3: 89,204,081 P51L probably benign Het
Glb1l2 T C 9: 26,796,532 D60G probably benign Het
Gm20767 T A 13: 120,154,813 W63R probably damaging Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Itih2 A G 2: 10,123,413 V159A possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lrch1 C T 14: 74,817,085 R323Q probably damaging Het
Lrrc30 T C 17: 67,631,865 N240S probably benign Het
Ncor1 T C 11: 62,343,302 H682R probably damaging Het
Olfr115 A T 17: 37,610,313 V146E probably damaging Het
Pax9 C A 12: 56,696,863 F98L probably damaging Het
Phlpp1 G A 1: 106,287,103 R585Q probably damaging Het
Prkdc A G 16: 15,795,075 T3166A probably benign Het
Prr11 T A 11: 87,097,177 Q300L possibly damaging Het
Rad50 T A 11: 53,684,235 E620D probably benign Het
Rpl3 A T 15: 80,083,345 probably null Het
Sacs G T 14: 61,191,248 G252V probably damaging Het
Serpina3i T A 12: 104,266,517 V227E probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snx19 T C 9: 30,427,743 V59A possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tsc1 G A 2: 28,671,886 probably null Het
Vmn2r61 C T 7: 42,265,859 Q77* probably null Het
Wdr72 A G 9: 74,213,361 H954R probably benign Het
Zbtb21 T C 16: 97,956,772 M20V probably benign Het
Zkscan16 A T 4: 58,956,483 D255V probably damaging Het
Other mutations in Mrgpra9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Mrgpra9 APN 7 47235091 missense possibly damaging 0.85
IGL00575:Mrgpra9 APN 7 47235305 missense possibly damaging 0.76
IGL01649:Mrgpra9 APN 7 47235152 missense probably benign 0.22
IGL03207:Mrgpra9 APN 7 47235637 missense possibly damaging 0.68
R0388:Mrgpra9 UTSW 7 47252794 start codon destroyed probably null 0.08
R0972:Mrgpra9 UTSW 7 47235455 missense probably damaging 0.99
R1270:Mrgpra9 UTSW 7 47252783 critical splice donor site probably null
R1381:Mrgpra9 UTSW 7 47235302 missense possibly damaging 0.75
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1403:Mrgpra9 UTSW 7 47235638 missense probably benign 0.24
R1448:Mrgpra9 UTSW 7 47235813 missense probably benign 0.02
R2045:Mrgpra9 UTSW 7 47235835 missense probably benign
R2144:Mrgpra9 UTSW 7 47235463 missense probably benign 0.31
R2187:Mrgpra9 UTSW 7 47235049 missense probably damaging 1.00
R2507:Mrgpra9 UTSW 7 47235494 missense possibly damaging 0.63
R2913:Mrgpra9 UTSW 7 47235080 missense probably benign
R3810:Mrgpra9 UTSW 7 47235779 missense probably damaging 0.98
R4177:Mrgpra9 UTSW 7 47235554 missense probably damaging 1.00
R4521:Mrgpra9 UTSW 7 47235190 missense probably damaging 1.00
R4781:Mrgpra9 UTSW 7 47235047 missense possibly damaging 0.88
R4926:Mrgpra9 UTSW 7 47235011 missense possibly damaging 0.62
R6505:Mrgpra9 UTSW 7 47235136 missense probably benign 0.00
R6724:Mrgpra9 UTSW 7 47235038 missense probably damaging 1.00
R7398:Mrgpra9 UTSW 7 47235637 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGGCAGAGGCTCTTCATCAC -3'
(R):5'- TGTAGTCCTCTGTGTGTCCAGC -3'

Sequencing Primer
(F):5'- AGAGGCTCTTCATCACGGCTC -3'
(R):5'- TGTGTCCAGCCTGGCTCTG -3'
Posted On2018-06-06