Incidental Mutation 'R6534:Zfp69'
ID520263
Institutional Source Beutler Lab
Gene Symbol Zfp69
Ensembl Gene ENSMUSG00000064141
Gene Namezinc finger protein 69
SynonymsZfp63, LOC381549, KRAB2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6534 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location120930137-120951699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120931197 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 307 (Y307C)
Ref Sequence ENSEMBL: ENSMUSP00000101888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106280] [ENSMUST00000106281] [ENSMUST00000130702]
Predicted Effect probably benign
Transcript: ENSMUST00000106280
AA Change: Y307C

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101887
Gene: ENSMUSG00000064141
AA Change: Y307C

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106281
AA Change: Y307C

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101888
Gene: ENSMUSG00000064141
AA Change: Y307C

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130702
SMART Domains Protein: ENSMUSP00000133312
Gene: ENSMUSG00000064141

DomainStartEndE-ValueType
KRAB 1 32 2.6e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132839
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 A T 7: 98,226,448 L142M probably benign Het
Adgrb2 T C 4: 130,022,219 F1435L probably damaging Het
Anapc13 T C 9: 102,634,093 L60P probably damaging Het
Apaf1 T C 10: 91,056,000 D497G probably damaging Het
Arpc1b A T 5: 145,122,567 I34F probably damaging Het
Atp2a2 A T 5: 122,457,198 W1030R possibly damaging Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Ddx10 A G 9: 53,223,688 Y399H probably damaging Het
Dnah9 T C 11: 65,955,248 E2988G probably damaging Het
Dock10 T C 1: 80,503,671 I536M probably benign Het
Drc7 T C 8: 95,071,282 Y443H probably damaging Het
Ecel1 A G 1: 87,154,842 S50P probably benign Het
Esco1 T A 18: 10,594,794 Q164L possibly damaging Het
Exosc7 A G 9: 123,132,012 D248G probably benign Het
Galnt3 A G 2: 66,102,531 L201P probably damaging Het
Hand2 C A 8: 57,322,036 H44N probably benign Het
Kcnq1 C T 7: 143,194,327 P411S probably benign Het
Lonp2 A G 8: 86,716,458 D429G probably benign Het
Magi3 A G 3: 104,085,220 I312T possibly damaging Het
Mansc4 A T 6: 147,086,873 I31N probably damaging Het
Mill2 T A 7: 18,856,596 D200E possibly damaging Het
Olfr74 G A 2: 87,974,041 A208V probably benign Het
Pde4d A G 13: 109,632,901 K41R probably benign Het
Pik3r5 G A 11: 68,490,617 D210N possibly damaging Het
Plcl1 C T 1: 55,696,748 T416I probably damaging Het
Plekhd1 T C 12: 80,707,257 Y166H probably damaging Het
Prrc1 A G 18: 57,389,274 T393A probably damaging Het
Scaper A T 9: 55,883,976 C213S probably benign Het
Sfxn4 T C 19: 60,839,023 I298V probably damaging Het
Slc36a2 A T 11: 55,184,867 D31E probably benign Het
Stra6l G A 4: 45,860,041 probably null Het
Tnpo3 A T 6: 29,572,703 probably null Het
Tonsl A G 15: 76,629,677 Y1231H probably damaging Het
Ush2a C A 1: 188,451,802 Y1434* probably null Het
Other mutations in Zfp69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Zfp69 APN 4 120931500 missense probably damaging 1.00
IGL02604:Zfp69 APN 4 120931463 missense probably benign 0.10
IGL03406:Zfp69 APN 4 120931084 missense probably benign
R0505:Zfp69 UTSW 4 120931095 missense probably damaging 1.00
R0613:Zfp69 UTSW 4 120934347 missense probably benign
R0628:Zfp69 UTSW 4 120949425 nonsense probably null
R0838:Zfp69 UTSW 4 120931281 missense probably benign 0.09
R1669:Zfp69 UTSW 4 120947498 utr 5 prime probably benign
R2060:Zfp69 UTSW 4 120930832 missense probably damaging 0.98
R3740:Zfp69 UTSW 4 120930874 splice site probably null
R4242:Zfp69 UTSW 4 120934475 intron probably benign
R4770:Zfp69 UTSW 4 120934417 missense probably damaging 0.99
R4998:Zfp69 UTSW 4 120947325 missense possibly damaging 0.52
R5620:Zfp69 UTSW 4 120930522 missense probably damaging 1.00
R6312:Zfp69 UTSW 4 120949517 unclassified probably benign
R7056:Zfp69 UTSW 4 120931098 missense probably benign 0.01
R7061:Zfp69 UTSW 4 120931401 missense possibly damaging 0.69
R7663:Zfp69 UTSW 4 120935126 missense probably benign 0.17
R8169:Zfp69 UTSW 4 120930534 missense probably damaging 1.00
R8348:Zfp69 UTSW 4 120930637 missense probably damaging 1.00
R8389:Zfp69 UTSW 4 120949352 missense possibly damaging 0.93
RF053:Zfp69 UTSW 4 120947347 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- TCACATGCGAAGGGCTTCTC -3'
(R):5'- CCTCCAGCTACAGTGATACATTAG -3'

Sequencing Primer
(F):5'- CCCAGTGTGGATCCTCTGGTG -3'
(R):5'- TACATTAGAGAGTCACCGGGC -3'
Posted On2018-06-06