Incidental Mutation 'R6534:Arpc1b'
ID 520269
Institutional Source Beutler Lab
Gene Symbol Arpc1b
Ensembl Gene ENSMUSG00000029622
Gene Name actin related protein 2/3 complex, subunit 1B
Synonyms L72, p41-ARC, SOP2Hs
MMRRC Submission 044660-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6534 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 145051066-145064996 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 145059377 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 34 (I34F)
Ref Sequence ENSEMBL: ENSMUSP00000082822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085679] [ENSMUST00000136074] [ENSMUST00000196111] [ENSMUST00000141602]
AlphaFold Q9WV32
Predicted Effect probably damaging
Transcript: ENSMUST00000085679
AA Change: I34F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082822
Gene: ENSMUSG00000029622
AA Change: I34F

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 233 271 9e-18 BLAST
WD40 317 358 3.55e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129033
Predicted Effect probably benign
Transcript: ENSMUST00000136074
SMART Domains Protein: ENSMUSP00000115022
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Pfam:WD40 3 29 2.5e-3 PFAM
WD40 77 121 1.79e-1 SMART
WD40 142 181 7.7e-1 SMART
Blast:WD40 184 222 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138900
Predicted Effect probably damaging
Transcript: ENSMUST00000196111
AA Change: I34F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143438
Gene: ENSMUSG00000029622
AA Change: I34F

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 237 275 2e-16 BLAST
WD40 321 362 3.55e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141602
AA Change: I34F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122340
Gene: ENSMUSG00000029622
AA Change: I34F

DomainStartEndE-ValueType
Blast:WD40 1 36 2e-15 BLAST
PDB:2P9U|C 1 56 2e-33 PDB
SCOP:d1k8kc_ 9 56 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138922
SMART Domains Protein: ENSMUSP00000115515
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
PDB:2P9U|C 2 93 4e-43 PDB
SCOP:d1k8kc_ 35 93 2e-11 SMART
Blast:WD40 50 87 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144375
Meta Mutation Damage Score 0.5723 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 A T 7: 97,875,655 (GRCm39) L142M probably benign Het
Adgrb2 T C 4: 129,916,012 (GRCm39) F1435L probably damaging Het
Anapc13 T C 9: 102,511,292 (GRCm39) L60P probably damaging Het
Apaf1 T C 10: 90,891,862 (GRCm39) D497G probably damaging Het
Atp2a2 A T 5: 122,595,261 (GRCm39) W1030R possibly damaging Het
Cdk5rap2 T C 4: 70,273,050 (GRCm39) E241G probably damaging Het
Cyp4a14 T A 4: 115,347,156 (GRCm39) probably null Het
Ddx10 A G 9: 53,134,988 (GRCm39) Y399H probably damaging Het
Dnah9 T C 11: 65,846,074 (GRCm39) E2988G probably damaging Het
Dock10 T C 1: 80,481,388 (GRCm39) I536M probably benign Het
Drc7 T C 8: 95,797,910 (GRCm39) Y443H probably damaging Het
Ecel1 A G 1: 87,082,564 (GRCm39) S50P probably benign Het
Esco1 T A 18: 10,594,794 (GRCm39) Q164L possibly damaging Het
Exosc7 A G 9: 122,961,077 (GRCm39) D248G probably benign Het
Galnt3 A G 2: 65,932,875 (GRCm39) L201P probably damaging Het
Hand2 C A 8: 57,775,071 (GRCm39) H44N probably benign Het
Kcnq1 C T 7: 142,748,064 (GRCm39) P411S probably benign Het
Lonp2 A G 8: 87,443,086 (GRCm39) D429G probably benign Het
Magi3 A G 3: 103,992,536 (GRCm39) I312T possibly damaging Het
Mansc4 A T 6: 146,988,371 (GRCm39) I31N probably damaging Het
Mill2 T A 7: 18,590,521 (GRCm39) D200E possibly damaging Het
Or5d47 G A 2: 87,804,385 (GRCm39) A208V probably benign Het
Pde4d A G 13: 109,769,435 (GRCm39) K41R probably benign Het
Pik3r5 G A 11: 68,381,443 (GRCm39) D210N possibly damaging Het
Plcl1 C T 1: 55,735,907 (GRCm39) T416I probably damaging Het
Plekhd1 T C 12: 80,754,031 (GRCm39) Y166H probably damaging Het
Prrc1 A G 18: 57,522,346 (GRCm39) T393A probably damaging Het
Scaper A T 9: 55,791,260 (GRCm39) C213S probably benign Het
Sfxn4 T C 19: 60,827,461 (GRCm39) I298V probably damaging Het
Slc36a2 A T 11: 55,075,693 (GRCm39) D31E probably benign Het
Stra6l G A 4: 45,860,041 (GRCm39) probably null Het
Tnpo3 A T 6: 29,572,702 (GRCm39) probably null Het
Tonsl A G 15: 76,513,877 (GRCm39) Y1231H probably damaging Het
Ush2a C A 1: 188,183,999 (GRCm39) Y1434* probably null Het
Zfp69 T C 4: 120,788,394 (GRCm39) Y307C probably benign Het
Other mutations in Arpc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Arpc1b APN 5 145,064,679 (GRCm39) utr 3 prime probably benign
IGL01625:Arpc1b APN 5 145,058,555 (GRCm39) splice site probably null
IGL01859:Arpc1b APN 5 145,060,540 (GRCm39) missense probably damaging 0.98
illusory UTSW 5 145,059,377 (GRCm39) missense probably damaging 1.00
FR4304:Arpc1b UTSW 5 145,063,601 (GRCm39) frame shift probably null
FR4340:Arpc1b UTSW 5 145,063,602 (GRCm39) frame shift probably null
FR4737:Arpc1b UTSW 5 145,063,597 (GRCm39) frame shift probably null
R0110:Arpc1b UTSW 5 145,064,525 (GRCm39) missense probably damaging 1.00
R0245:Arpc1b UTSW 5 145,063,670 (GRCm39) missense probably damaging 1.00
R0469:Arpc1b UTSW 5 145,064,525 (GRCm39) missense probably damaging 1.00
R0652:Arpc1b UTSW 5 145,063,670 (GRCm39) missense probably damaging 1.00
R0827:Arpc1b UTSW 5 145,062,566 (GRCm39) missense probably benign 0.34
R1117:Arpc1b UTSW 5 145,062,564 (GRCm39) missense possibly damaging 0.95
R1453:Arpc1b UTSW 5 145,062,555 (GRCm39) missense probably damaging 1.00
R1895:Arpc1b UTSW 5 145,059,443 (GRCm39) missense probably null 0.99
R1946:Arpc1b UTSW 5 145,059,443 (GRCm39) missense probably null 0.99
R2050:Arpc1b UTSW 5 145,062,729 (GRCm39) missense probably damaging 1.00
R2112:Arpc1b UTSW 5 145,060,579 (GRCm39) missense probably damaging 0.99
R4924:Arpc1b UTSW 5 145,063,625 (GRCm39) missense probably benign 0.02
R6883:Arpc1b UTSW 5 145,063,739 (GRCm39) missense probably benign 0.31
R8523:Arpc1b UTSW 5 145,061,492 (GRCm39) missense probably damaging 1.00
R8854:Arpc1b UTSW 5 145,060,405 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGTAACGGGACTTTTGCTAAC -3'
(R):5'- AAATCAACTGGGATCAGAGTCCTTTTC -3'

Sequencing Primer
(F):5'- GGACTTTTGCTAACACAGAGCTG -3'
(R):5'- GGGATCAGAGTCCTTTTCATTGCAAC -3'
Posted On 2018-06-06