Incidental Mutation 'R6469:Rad50'
ID520276
Institutional Source Beutler Lab
Gene Symbol Rad50
Ensembl Gene ENSMUSG00000020380
Gene NameRAD50 double strand break repair protein
SynonymsRad50l, Mrell
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6469 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53649519-53707319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53684235 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 620 (E620D)
Ref Sequence ENSEMBL: ENSMUSP00000020649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020649] [ENSMUST00000124352] [ENSMUST00000128483]
Predicted Effect probably benign
Transcript: ENSMUST00000020649
AA Change: E620D

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020649
Gene: ENSMUSG00000020380
AA Change: E620D

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 1.8e-31 PFAM
coiled coil region 397 534 N/A INTRINSIC
Pfam:Rad50_zn_hook 659 712 9.9e-16 PFAM
low complexity region 825 836 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
coiled coil region 1019 1075 N/A INTRINSIC
Pfam:SbcCD_C 1174 1251 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124352
AA Change: E559D

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119618
Gene: ENSMUSG00000020380
AA Change: E559D

DomainStartEndE-ValueType
Pfam:AAA_23 6 290 2.7e-24 PFAM
coiled coil region 397 469 N/A INTRINSIC
Pfam:Rad50_zn_hook 597 652 1.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126121
Predicted Effect probably benign
Transcript: ENSMUST00000128483
SMART Domains Protein: ENSMUSP00000120869
Gene: ENSMUSG00000020380

DomainStartEndE-ValueType
Pfam:AAA_23 6 295 6e-23 PFAM
coiled coil region 397 534 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Saccharomyces cerevisiae Rad50, a protein involved in DNA double-strand break repair. This protein forms a complex with MRE11 and NBS1. The protein complex binds to DNA and displays numerous enzymatic activities that are required for nonhomologous joining of DNA ends. This protein, cooperating with its partners, is important for DNA double-strand break repair, cell cycle checkpoint activation, telomere maintenance, and meiotic recombination. Knockout studies of the mouse homolog suggest this gene is essential for cell growth and viability. Mutations in this gene are the cause of Nijmegen breakage syndrome-like disorder.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for a targeted hypomorphic mutation exhibit growth defects, predisposition toward cancer, progressive loss of hematopoietic and spermatogenic stem cells, and lethality due to bone marrow depletion. A null mutation results in embryonic death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T G 3: 138,066,975 S642A probably damaging Het
Aadacl2 A T 3: 60,024,789 T242S probably benign Het
Adprh T C 16: 38,450,309 M45V probably benign Het
Akr1c13 T C 13: 4,196,512 probably null Het
Ap3d1 A C 10: 80,712,158 V900G probably benign Het
Bak1 G A 17: 27,021,319 R125C probably damaging Het
Bmpr1b T C 3: 141,856,461 T322A possibly damaging Het
Camsap3 T A 8: 3,603,941 L521Q possibly damaging Het
Col6a6 A T 9: 105,698,691 F2157I probably damaging Het
Dcun1d4 G A 5: 73,534,614 M155I probably damaging Het
Diaph3 T C 14: 86,656,538 S12G possibly damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fgb A T 3: 83,046,142 L107* probably null Het
Ganab T C 19: 8,902,632 probably null Het
Gba C T 3: 89,204,081 P51L probably benign Het
Glb1l2 T C 9: 26,796,532 D60G probably benign Het
Gm20767 T A 13: 120,154,813 W63R probably damaging Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Itih2 A G 2: 10,123,413 V159A possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lrch1 C T 14: 74,817,085 R323Q probably damaging Het
Lrrc30 T C 17: 67,631,865 N240S probably benign Het
Mrgpra9 T C 7: 47,235,106 Y271C probably benign Het
Ncor1 T C 11: 62,343,302 H682R probably damaging Het
Olfr115 A T 17: 37,610,313 V146E probably damaging Het
Pax9 C A 12: 56,696,863 F98L probably damaging Het
Phlpp1 G A 1: 106,287,103 R585Q probably damaging Het
Prkdc A G 16: 15,795,075 T3166A probably benign Het
Prr11 T A 11: 87,097,177 Q300L possibly damaging Het
Rpl3 A T 15: 80,083,345 probably null Het
Sacs G T 14: 61,191,248 G252V probably damaging Het
Serpina3i T A 12: 104,266,517 V227E probably damaging Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Snx19 T C 9: 30,427,743 V59A possibly damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tsc1 G A 2: 28,671,886 probably null Het
Vmn2r61 C T 7: 42,265,859 Q77* probably null Het
Wdr72 A G 9: 74,213,361 H954R probably benign Het
Zbtb21 T C 16: 97,956,772 M20V probably benign Het
Zkscan16 A T 4: 58,956,483 D255V probably damaging Het
Other mutations in Rad50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Rad50 APN 11 53686311 intron probably benign
IGL00709:Rad50 APN 11 53669642 missense possibly damaging 0.49
IGL01080:Rad50 APN 11 53706068 missense probably damaging 1.00
IGL01357:Rad50 APN 11 53707021 missense probably damaging 1.00
IGL01979:Rad50 APN 11 53686178 nonsense probably null
IGL02481:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02483:Rad50 APN 11 53680049 missense probably benign 0.20
IGL02673:Rad50 APN 11 53688240 missense probably benign 0.19
IGL02754:Rad50 APN 11 53702056 missense probably damaging 1.00
IGL03372:Rad50 APN 11 53695294 missense probably benign 0.20
PIT4131001:Rad50 UTSW 11 53694899 critical splice donor site probably null
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0035:Rad50 UTSW 11 53655027 splice site probably benign
R0270:Rad50 UTSW 11 53668025 missense probably damaging 1.00
R0373:Rad50 UTSW 11 53650519 missense probably damaging 1.00
R0567:Rad50 UTSW 11 53654956 missense probably damaging 1.00
R1132:Rad50 UTSW 11 53694961 missense possibly damaging 0.58
R1249:Rad50 UTSW 11 53692137 missense probably damaging 0.99
R1368:Rad50 UTSW 11 53683245 nonsense probably null
R1501:Rad50 UTSW 11 53688151 missense possibly damaging 0.68
R1506:Rad50 UTSW 11 53679485 missense probably damaging 0.98
R1633:Rad50 UTSW 11 53692859 missense probably benign 0.00
R1663:Rad50 UTSW 11 53668223 missense probably benign 0.01
R1847:Rad50 UTSW 11 53702107 missense possibly damaging 0.68
R1933:Rad50 UTSW 11 53680061 missense probably benign 0.16
R2176:Rad50 UTSW 11 53698209 missense probably benign 0.00
R2519:Rad50 UTSW 11 53707185 start gained probably benign
R3027:Rad50 UTSW 11 53695381 missense probably benign 0.00
R3894:Rad50 UTSW 11 53678870 missense probably benign 0.01
R4181:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4302:Rad50 UTSW 11 53702005 missense probably benign 0.00
R4836:Rad50 UTSW 11 53650653 missense probably damaging 1.00
R4934:Rad50 UTSW 11 53684275 missense probably benign 0.05
R5047:Rad50 UTSW 11 53674696 critical splice donor site probably null
R5201:Rad50 UTSW 11 53698820 critical splice donor site probably null
R5325:Rad50 UTSW 11 53692863 missense probably benign 0.16
R5368:Rad50 UTSW 11 53684246 missense probably benign 0.02
R5403:Rad50 UTSW 11 53695281 critical splice donor site probably null
R5421:Rad50 UTSW 11 53674946 missense probably benign 0.02
R6282:Rad50 UTSW 11 53669770 splice site probably null
R6468:Rad50 UTSW 11 53692144 missense possibly damaging 0.81
R6528:Rad50 UTSW 11 53652282 missense probably damaging 1.00
R6704:Rad50 UTSW 11 53698918 missense probably damaging 1.00
R6886:Rad50 UTSW 11 53686184 missense probably benign 0.01
R7055:Rad50 UTSW 11 53688102 missense probably benign 0.02
R7268:Rad50 UTSW 11 53684275 missense probably benign 0.01
R7288:Rad50 UTSW 11 53654949 nonsense probably null
R7380:Rad50 UTSW 11 53695396 missense probably benign 0.00
R7467:Rad50 UTSW 11 53654908 missense probably damaging 1.00
R7533:Rad50 UTSW 11 53698919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTAGCAGTTACCTGTGAATG -3'
(R):5'- GAGTTTGTGTAGTAGCTCTTTAACC -3'

Sequencing Primer
(F):5'- GCAGTTACCTGTGAATGAAATTTC -3'
(R):5'- TTTGGGTCCCAGGCACATACATAG -3'
Posted On2018-06-06