Incidental Mutation 'R6534:Scaper'
ID520291
Institutional Source Beutler Lab
Gene Symbol Scaper
Ensembl Gene ENSMUSG00000034007
Gene NameS phase cyclin A-associated protein in the ER
SynonymsD530014O03Rik, Zfp291
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R6534 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location55549879-55938119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55883976 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 213 (C213S)
Ref Sequence ENSEMBL: ENSMUSP00000149050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037408] [ENSMUST00000214747] [ENSMUST00000216595] [ENSMUST00000217647]
Predicted Effect probably benign
Transcript: ENSMUST00000037408
AA Change: C213S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043411
Gene: ENSMUSG00000034007
AA Change: C213S

DomainStartEndE-ValueType
Pfam:SCAPER_N 88 185 3.4e-47 PFAM
low complexity region 323 338 N/A INTRINSIC
coiled coil region 415 466 N/A INTRINSIC
coiled coil region 535 597 N/A INTRINSIC
SCOP:d1eq1a_ 605 769 3e-6 SMART
ZnF_C2H2 791 815 1.16e1 SMART
low complexity region 866 883 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214747
AA Change: C213S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000216595
AA Change: C213S
Predicted Effect probably benign
Transcript: ENSMUST00000217647
AA Change: C213S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 A T 7: 98,226,448 L142M probably benign Het
Adgrb2 T C 4: 130,022,219 F1435L probably damaging Het
Anapc13 T C 9: 102,634,093 L60P probably damaging Het
Apaf1 T C 10: 91,056,000 D497G probably damaging Het
Arpc1b A T 5: 145,122,567 I34F probably damaging Het
Atp2a2 A T 5: 122,457,198 W1030R possibly damaging Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Ddx10 A G 9: 53,223,688 Y399H probably damaging Het
Dnah9 T C 11: 65,955,248 E2988G probably damaging Het
Dock10 T C 1: 80,503,671 I536M probably benign Het
Drc7 T C 8: 95,071,282 Y443H probably damaging Het
Ecel1 A G 1: 87,154,842 S50P probably benign Het
Esco1 T A 18: 10,594,794 Q164L possibly damaging Het
Exosc7 A G 9: 123,132,012 D248G probably benign Het
Galnt3 A G 2: 66,102,531 L201P probably damaging Het
Hand2 C A 8: 57,322,036 H44N probably benign Het
Kcnq1 C T 7: 143,194,327 P411S probably benign Het
Lonp2 A G 8: 86,716,458 D429G probably benign Het
Magi3 A G 3: 104,085,220 I312T possibly damaging Het
Mansc4 A T 6: 147,086,873 I31N probably damaging Het
Mill2 T A 7: 18,856,596 D200E possibly damaging Het
Olfr74 G A 2: 87,974,041 A208V probably benign Het
Pde4d A G 13: 109,632,901 K41R probably benign Het
Pik3r5 G A 11: 68,490,617 D210N possibly damaging Het
Plcl1 C T 1: 55,696,748 T416I probably damaging Het
Plekhd1 T C 12: 80,707,257 Y166H probably damaging Het
Prrc1 A G 18: 57,389,274 T393A probably damaging Het
Sfxn4 T C 19: 60,839,023 I298V probably damaging Het
Slc36a2 A T 11: 55,184,867 D31E probably benign Het
Stra6l G A 4: 45,860,041 probably null Het
Tnpo3 A T 6: 29,572,703 probably null Het
Tonsl A G 15: 76,629,677 Y1231H probably damaging Het
Ush2a C A 1: 188,451,802 Y1434* probably null Het
Zfp69 T C 4: 120,931,197 Y307C probably benign Het
Other mutations in Scaper
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00653:Scaper APN 9 55859859 missense probably damaging 0.99
IGL00912:Scaper APN 9 55685955 missense probably damaging 1.00
IGL01469:Scaper APN 9 55859767 missense probably damaging 1.00
IGL01626:Scaper APN 9 55912051 missense possibly damaging 0.61
IGL01779:Scaper APN 9 55892240 missense probably benign 0.20
IGL02011:Scaper APN 9 55580322 missense probably damaging 1.00
IGL02997:Scaper APN 9 55815499 missense probably damaging 1.00
IGL03107:Scaper APN 9 55858402 splice site probably benign
IGL03167:Scaper APN 9 55859824 missense probably damaging 1.00
IGL03293:Scaper APN 9 55874823 missense probably benign
IGL03340:Scaper APN 9 55602832 missense possibly damaging 0.88
IGL03368:Scaper APN 9 55656027 missense possibly damaging 0.53
R0111:Scaper UTSW 9 55602790 missense probably benign 0.01
R0510:Scaper UTSW 9 55758062 splice site probably benign
R0531:Scaper UTSW 9 55609874 missense possibly damaging 0.91
R0558:Scaper UTSW 9 55685923 missense probably benign 0.08
R0605:Scaper UTSW 9 55815518 splice site probably benign
R0646:Scaper UTSW 9 55758056 missense probably damaging 1.00
R0837:Scaper UTSW 9 55859042 nonsense probably null
R1440:Scaper UTSW 9 55602918 nonsense probably null
R1548:Scaper UTSW 9 55816670 missense probably damaging 1.00
R1777:Scaper UTSW 9 55864546 missense probably benign 0.33
R1822:Scaper UTSW 9 55859900 missense probably damaging 0.99
R1834:Scaper UTSW 9 55816734 missense possibly damaging 0.90
R1870:Scaper UTSW 9 55685938 missense probably damaging 1.00
R2102:Scaper UTSW 9 55912050 missense probably benign 0.43
R2168:Scaper UTSW 9 55743639 missense probably damaging 1.00
R2174:Scaper UTSW 9 55859037 missense probably null 0.01
R3690:Scaper UTSW 9 55883921 missense probably benign 0.00
R4392:Scaper UTSW 9 55858115 missense probably damaging 0.99
R4418:Scaper UTSW 9 55838180 missense probably damaging 1.00
R4606:Scaper UTSW 9 55655903 critical splice donor site probably null
R4643:Scaper UTSW 9 55838179 missense probably damaging 0.99
R4665:Scaper UTSW 9 55912055 missense probably damaging 1.00
R4739:Scaper UTSW 9 55743648 missense probably damaging 1.00
R4921:Scaper UTSW 9 55892235 missense probably benign 0.02
R4934:Scaper UTSW 9 55809175 missense probably damaging 1.00
R4956:Scaper UTSW 9 55838142 missense probably damaging 1.00
R5055:Scaper UTSW 9 55859719 intron probably null
R5107:Scaper UTSW 9 55580332 missense probably damaging 1.00
R5155:Scaper UTSW 9 55556086 missense probably null 1.00
R5265:Scaper UTSW 9 55864546 missense probably benign
R5408:Scaper UTSW 9 55586224 missense probably damaging 0.99
R5623:Scaper UTSW 9 55864507 missense probably benign 0.02
R5665:Scaper UTSW 9 55807632 missense probably damaging 1.00
R5748:Scaper UTSW 9 55859076 critical splice acceptor site probably null
R5771:Scaper UTSW 9 55816791 missense probably damaging 1.00
R6557:Scaper UTSW 9 55550850 missense probably benign 0.02
R6651:Scaper UTSW 9 55858504 missense probably benign 0.05
R6796:Scaper UTSW 9 55864427 missense probably benign 0.00
R6962:Scaper UTSW 9 55859771 missense probably benign 0.01
R7145:Scaper UTSW 9 55912111 missense unknown
R7199:Scaper UTSW 9 55838176 nonsense probably null
R7356:Scaper UTSW 9 55892211 missense unknown
R7426:Scaper UTSW 9 55762277 nonsense probably null
R7503:Scaper UTSW 9 55807754 missense probably damaging 0.98
X0012:Scaper UTSW 9 55655930 missense probably damaging 0.98
X0052:Scaper UTSW 9 55816664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTTTCTAACTATAGGCAGCTAAAAC -3'
(R):5'- TGCTTAGAAGAAGGAGCAGTTTTAG -3'

Sequencing Primer
(F):5'- GTCATTGGTGCACAGGAT -3'
(R):5'- CAGTTTTAGTAGTGACTGAGTCAAG -3'
Posted On2018-06-06