Mutagenetix > Incidental Mutations

Incidental Mutation 'R6534:Apaf1'

520297

Institutional Source

Beutler Lab

Gene Symbol

Apaf1

Ensembl Gene

ENSMUSG00000019979

Gene Name

apoptotic peptidase activating factor 1

Synonyms

Apaf1l, 6230400I06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6534 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90989311-91082770 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 91056000 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 497 (D497G)

Ref Sequence

ENSEMBL: ENSMUSP00000124134 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020157] [ENSMUST00000159110] [ENSMUST00000162618]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020157
AA Change: D508G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000020157
Gene: ENSMUSG00000019979
AA Change: D508G

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.3e-22	PFAM
Pfam:NB-ARC	129	414	1.7e-77	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159110
AA Change: D508G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000125291
Gene: ENSMUSG00000019979
AA Change: D508G

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	7.4e-21	PFAM
Pfam:NB-ARC	129	414	6.9e-71	PFAM
WD40	604	643	1.35e-5	SMART
WD40	646	685	1.04e-11	SMART
WD40	688	729	2.98e-7	SMART
WD40	732	771	9.88e-13	SMART
WD40	780	825	1.28e1	SMART
WD40	828	868	1.43e0	SMART
WD40	871	910	3.24e-8	SMART
WD40	952	989	2.57e0	SMART
WD40	992	1031	1.09e-5	SMART
WD40	1033	1071	2.09e-2	SMART
WD40	1074	1113	2.93e-6	SMART
WD40	1116	1155	8.55e-8	SMART
WD40	1168	1204	4.55e-3	SMART
Blast:WD40	1207	1246	5e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000162618
AA Change: D497G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000124134
Gene: ENSMUSG00000019979
AA Change: D497G

Domain	Start	End	E-Value	Type
Pfam:CARD	6	90	1.1e-20	PFAM
Pfam:NB-ARC	118	403	8.8e-72	PFAM
WD40	593	632	1.35e-5	SMART
WD40	635	674	1.04e-11	SMART
WD40	677	718	2.98e-7	SMART
WD40	721	760	9.88e-13	SMART
WD40	769	814	1.28e1	SMART
WD40	817	857	1.43e0	SMART
WD40	860	899	3.24e-8	SMART
WD40	941	978	2.57e0	SMART
WD40	981	1020	1.09e-5	SMART
WD40	1022	1060	2.09e-2	SMART
WD40	1063	1102	2.93e-6	SMART
WD40	1105	1144	8.55e-8	SMART
WD40	1157	1193	4.55e-3	SMART
Blast:WD40	1196	1235	5e-18	BLAST

Meta Mutation Damage Score

0.4377

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (37/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that initiates apoptosis. This protein contains several copies of the WD-40 domain, a caspase recruitment domain (CARD), and an ATPase domain (NB-ARC). Upon binding cytochrome c and dATP, this protein forms an oligomeric apoptosome. The apoptosome binds and cleaves caspase 9 preproprotein, releasing its mature, activated form. Activated caspase 9 stimulates the subsequent caspase cascade that commits the cell to apoptosis. Alternative splicing results in several transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects in apoptosis resulting in brain overgrowth, craniofacial defects, interdigit webbing and altered lens and retina. Most mutants die by embryonic day 16.5 or perinatally, and male survivors are sterile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer3	A	T	7: 98,226,448	L142M	probably benign	Het
Adgrb2	T	C	4: 130,022,219	F1435L	probably damaging	Het
Anapc13	T	C	9: 102,634,093	L60P	probably damaging	Het
Arpc1b	A	T	5: 145,122,567	I34F	probably damaging	Het
Atp2a2	A	T	5: 122,457,198	W1030R	possibly damaging	Het
Cdk5rap2	T	C	4: 70,354,813	E241G	probably damaging	Het
Cyp4a14	T	A	4: 115,489,959		probably null	Het
Ddx10	A	G	9: 53,223,688	Y399H	probably damaging	Het
Dnah9	T	C	11: 65,955,248	E2988G	probably damaging	Het
Dock10	T	C	1: 80,503,671	I536M	probably benign	Het
Drc7	T	C	8: 95,071,282	Y443H	probably damaging	Het
Ecel1	A	G	1: 87,154,842	S50P	probably benign	Het
Esco1	T	A	18: 10,594,794	Q164L	possibly damaging	Het
Exosc7	A	G	9: 123,132,012	D248G	probably benign	Het
Galnt3	A	G	2: 66,102,531	L201P	probably damaging	Het
Hand2	C	A	8: 57,322,036	H44N	probably benign	Het
Kcnq1	C	T	7: 143,194,327	P411S	probably benign	Het
Lonp2	A	G	8: 86,716,458	D429G	probably benign	Het
Magi3	A	G	3: 104,085,220	I312T	possibly damaging	Het
Mansc4	A	T	6: 147,086,873	I31N	probably damaging	Het
Mill2	T	A	7: 18,856,596	D200E	possibly damaging	Het
Olfr74	G	A	2: 87,974,041	A208V	probably benign	Het
Pde4d	A	G	13: 109,632,901	K41R	probably benign	Het
Pik3r5	G	A	11: 68,490,617	D210N	possibly damaging	Het
Plcl1	C	T	1: 55,696,748	T416I	probably damaging	Het
Plekhd1	T	C	12: 80,707,257	Y166H	probably damaging	Het
Prrc1	A	G	18: 57,389,274	T393A	probably damaging	Het
Scaper	A	T	9: 55,883,976	C213S	probably benign	Het
Sfxn4	T	C	19: 60,839,023	I298V	probably damaging	Het
Slc36a2	A	T	11: 55,184,867	D31E	probably benign	Het
Stra6l	G	A	4: 45,860,041		probably null	Het
Tnpo3	A	T	6: 29,572,703		probably null	Het
Tonsl	A	G	15: 76,629,677	Y1231H	probably damaging	Het
Ush2a	C	A	1: 188,451,802	Y1434*	probably null	Het
Zfp69	T	C	4: 120,931,197	Y307C	probably benign	Het

Other mutations in Apaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Apaf1	APN	10	91023788	missense	probably damaging	0.99
IGL00819:Apaf1	APN	10	90997340	splice site	probably null
IGL01481:Apaf1	APN	10	91031588	missense	possibly damaging	0.84
IGL01713:Apaf1	APN	10	91061832	splice site	probably benign
IGL01715:Apaf1	APN	10	91058354	missense	probably benign	0.20
IGL02152:Apaf1	APN	10	91061819	missense	probably benign	0.24
IGL02331:Apaf1	APN	10	91059619	missense	probably damaging	1.00
IGL03071:Apaf1	APN	10	90997255	missense	possibly damaging	0.88
IGL03101:Apaf1	APN	10	91031559	missense	possibly damaging	0.89
IGL03244:Apaf1	APN	10	91049349	splice site	probably benign
Mayhem	UTSW	10	90999719	missense	probably damaging	0.99
Wipeout	UTSW	10	91056000	missense	probably damaging	1.00
R0520:Apaf1	UTSW	10	91079989	missense	probably damaging	0.99
R0600:Apaf1	UTSW	10	91060052	missense	probably damaging	1.00
R0607:Apaf1	UTSW	10	91009203	missense	probably damaging	1.00
R0688:Apaf1	UTSW	10	91061705	missense	possibly damaging	0.94
R0734:Apaf1	UTSW	10	91037021	missense	probably benign	0.02
R1256:Apaf1	UTSW	10	91058406	missense	probably benign
R1459:Apaf1	UTSW	10	91062160	missense	probably benign	0.00
R1485:Apaf1	UTSW	10	91060243	missense	probably benign	0.02
R1511:Apaf1	UTSW	10	91060185	missense	possibly damaging	0.81
R1531:Apaf1	UTSW	10	91054521	missense	probably damaging	1.00
R1705:Apaf1	UTSW	10	91067271	splice site	probably benign
R1919:Apaf1	UTSW	10	91077614	nonsense	probably null
R1925:Apaf1	UTSW	10	90999719	missense	probably damaging	0.99
R2001:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2002:Apaf1	UTSW	10	91061814	missense	possibly damaging	0.94
R2006:Apaf1	UTSW	10	91061772	missense	probably damaging	1.00
R2043:Apaf1	UTSW	10	91037028	missense	probably damaging	1.00
R2073:Apaf1	UTSW	10	91031694	nonsense	probably null
R2101:Apaf1	UTSW	10	91060080	missense	probably benign	0.26
R2130:Apaf1	UTSW	10	91060165	nonsense	probably null
R2153:Apaf1	UTSW	10	91048090	missense	probably damaging	1.00
R2377:Apaf1	UTSW	10	91079893	missense	possibly damaging	0.95
R2421:Apaf1	UTSW	10	91020723	missense	probably damaging	1.00
R3835:Apaf1	UTSW	10	91059587	missense	probably benign	0.07
R4750:Apaf1	UTSW	10	91060188	missense	probably damaging	1.00
R5100:Apaf1	UTSW	10	90997287	missense	probably benign
R5135:Apaf1	UTSW	10	91060094	missense	probably damaging	1.00
R5497:Apaf1	UTSW	10	90999656	missense	probably damaging	1.00
R5511:Apaf1	UTSW	10	91054392	missense	probably damaging	1.00
R5659:Apaf1	UTSW	10	91062153	nonsense	probably null
R5730:Apaf1	UTSW	10	91020771	missense	possibly damaging	0.62
R6176:Apaf1	UTSW	10	91059571	critical splice donor site	probably null
R6242:Apaf1	UTSW	10	91062163	missense	probably damaging	1.00
R6292:Apaf1	UTSW	10	90991563	missense	possibly damaging	0.86
R6376:Apaf1	UTSW	10	91023811	missense	probably damaging	1.00
R6975:Apaf1	UTSW	10	91020734	missense	probably damaging	0.97
R7218:Apaf1	UTSW	10	91037002	missense	probably damaging	1.00
R7369:Apaf1	UTSW	10	91001036	missense	probably damaging	0.97
R7409:Apaf1	UTSW	10	91067246	missense	probably damaging	1.00
R7413:Apaf1	UTSW	10	90995680	missense	probably benign	0.28
R7418:Apaf1	UTSW	10	91023835	missense	probably benign	0.09
R7423:Apaf1	UTSW	10	91059606	missense	probably damaging	1.00
R7488:Apaf1	UTSW	10	91054380	missense	probably benign	0.35
R7765:Apaf1	UTSW	10	91023782	missense	probably benign	0.34
R7913:Apaf1	UTSW	10	91060271	missense	probably damaging	0.99
R7914:Apaf1	UTSW	10	91060233	missense	probably damaging	1.00
R7922:Apaf1	UTSW	10	90999753	missense	probably benign
R8131:Apaf1	UTSW	10	91077558	missense	possibly damaging	0.93
R8158:Apaf1	UTSW	10	91059658	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GGCACAGCAAGAAGATGATCTC -3'
(R):5'- AGCTGTTGTGGCCCCATTTAC -3'

Sequencing Primer
(F):5'- GCACAGCAAGAAGATGATCTCTATTC -3'
(R):5'- GTGGCCCCATTTACATTTATTTTGAG -3'

Posted On

2018-06-06