Incidental Mutation 'R6534:Pde4d'
ID520307
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6534 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109632901 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 41 (K41R)
Ref Sequence ENSEMBL: ENSMUSP00000119583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079975] [ENSMUST00000119507] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect probably benign
Transcript: ENSMUST00000079975
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119507
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120671
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122041
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135275
AA Change: K41R

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: K41R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138938
Predicted Effect probably benign
Transcript: ENSMUST00000153234
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177907
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer3 A T 7: 98,226,448 L142M probably benign Het
Adgrb2 T C 4: 130,022,219 F1435L probably damaging Het
Anapc13 T C 9: 102,634,093 L60P probably damaging Het
Apaf1 T C 10: 91,056,000 D497G probably damaging Het
Arpc1b A T 5: 145,122,567 I34F probably damaging Het
Atp2a2 A T 5: 122,457,198 W1030R possibly damaging Het
Cdk5rap2 T C 4: 70,354,813 E241G probably damaging Het
Cyp4a14 T A 4: 115,489,959 probably null Het
Ddx10 A G 9: 53,223,688 Y399H probably damaging Het
Dnah9 T C 11: 65,955,248 E2988G probably damaging Het
Dock10 T C 1: 80,503,671 I536M probably benign Het
Drc7 T C 8: 95,071,282 Y443H probably damaging Het
Ecel1 A G 1: 87,154,842 S50P probably benign Het
Esco1 T A 18: 10,594,794 Q164L possibly damaging Het
Exosc7 A G 9: 123,132,012 D248G probably benign Het
Galnt3 A G 2: 66,102,531 L201P probably damaging Het
Hand2 C A 8: 57,322,036 H44N probably benign Het
Kcnq1 C T 7: 143,194,327 P411S probably benign Het
Lonp2 A G 8: 86,716,458 D429G probably benign Het
Magi3 A G 3: 104,085,220 I312T possibly damaging Het
Mansc4 A T 6: 147,086,873 I31N probably damaging Het
Mill2 T A 7: 18,856,596 D200E possibly damaging Het
Olfr74 G A 2: 87,974,041 A208V probably benign Het
Pik3r5 G A 11: 68,490,617 D210N possibly damaging Het
Plcl1 C T 1: 55,696,748 T416I probably damaging Het
Plekhd1 T C 12: 80,707,257 Y166H probably damaging Het
Prrc1 A G 18: 57,389,274 T393A probably damaging Het
Scaper A T 9: 55,883,976 C213S probably benign Het
Sfxn4 T C 19: 60,839,023 I298V probably damaging Het
Slc36a2 A T 11: 55,184,867 D31E probably benign Het
Stra6l G A 4: 45,860,041 probably null Het
Tnpo3 A T 6: 29,572,703 probably null Het
Tonsl A G 15: 76,629,677 Y1231H probably damaging Het
Ush2a C A 1: 188,451,802 Y1434* probably null Het
Zfp69 T C 4: 120,931,197 Y307C probably benign Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1225:Pde4d UTSW 13 109950221 missense probably benign 0.04
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
R7164:Pde4d UTSW 13 109032688 missense probably benign
R7222:Pde4d UTSW 13 109757579 missense probably damaging 1.00
R7417:Pde4d UTSW 13 109632788 synonymous probably null
R7489:Pde4d UTSW 13 109116767 missense unknown
R7563:Pde4d UTSW 13 109951007 missense probably benign 0.37
R7861:Pde4d UTSW 13 109935324 missense probably damaging 0.99
R7944:Pde4d UTSW 13 109935324 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATTCAGCCACAAGTGCC -3'
(R):5'- CAGAATGGGCTCTGAGAGTTG -3'

Sequencing Primer
(F):5'- GCCTCTTGCAGCCTGAAG -3'
(R):5'- TTGGGCAACTTCCTGCGAC -3'
Posted On2018-06-06