Incidental Mutation 'R6473:Idh3b'
ID520316
Institutional Source Beutler Lab
Gene Symbol Idh3b
Ensembl Gene ENSMUSG00000027406
Gene Nameisocitrate dehydrogenase 3 (NAD+) beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6473 (G1)
Quality Score216.468
Status Validated
Chromosome2
Chromosomal Location130279309-130284547 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AG to AGCACCACAACTG at 130279673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000159373] [ENSMUST00000184538]
Predicted Effect probably benign
Transcript: ENSMUST00000028890
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028892
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083355
Predicted Effect probably benign
Transcript: ENSMUST00000103198
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133351
Predicted Effect probably benign
Transcript: ENSMUST00000136621
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138163
Predicted Effect probably benign
Transcript: ENSMUST00000141872
SMART Domains Protein: ENSMUSP00000125305
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 14 79 3.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145335
Predicted Effect probably benign
Transcript: ENSMUST00000146454
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149843
Predicted Effect probably benign
Transcript: ENSMUST00000149955
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150401
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153353
Predicted Effect probably benign
Transcript: ENSMUST00000159373
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160183
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175746
Predicted Effect probably null
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
Ash2l T A 8: 25,834,980 T184S probably damaging Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Idh3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Idh3b APN 2 130281897 missense possibly damaging 0.87
IGL02821:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03057:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03106:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03159:Idh3b APN 2 130284401 missense probably benign 0.00
R0090:Idh3b UTSW 2 130280979 missense probably benign 0.01
R1191:Idh3b UTSW 2 130281890 missense probably benign 0.43
R1443:Idh3b UTSW 2 130284054 intron probably null
R1634:Idh3b UTSW 2 130281745 missense probably benign 0.39
R1644:Idh3b UTSW 2 130281510 missense possibly damaging 0.95
R5784:Idh3b UTSW 2 130279671 missense probably damaging 1.00
R5847:Idh3b UTSW 2 130284028 missense probably benign 0.00
R6469:Idh3b UTSW 2 130279673 frame shift probably null
R6532:Idh3b UTSW 2 130279673 frame shift probably null
R6536:Idh3b UTSW 2 130279673 frame shift probably null
R6959:Idh3b UTSW 2 130281527 missense probably damaging 1.00
R7019:Idh3b UTSW 2 130280966 missense probably damaging 1.00
R7305:Idh3b UTSW 2 130281493 missense possibly damaging 0.89
R7505:Idh3b UTSW 2 130284227 missense probably benign
R7505:Idh3b UTSW 2 130284233 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCATCTTAGGGTCTGGGCC -3'
(R):5'- TTACAGGCAGGGTTAGCTGC -3'

Sequencing Primer
(F):5'- TGGGCCTTGTCGCAACAAC -3'
(R):5'- GGTCTCATTTCTTGCAAGGTAAC -3'
Posted On2018-06-06