Incidental Mutation 'R6535:Hip1'
ID520327
Institutional Source Beutler Lab
Gene Symbol Hip1
Ensembl Gene ENSMUSG00000039959
Gene Namehuntingtin interacting protein 1
SynonymsHIP-1, 2610109B09Rik, A930014B11Rik, E130315I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location135406531-135545120 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 135428497 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144086 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060311] [ENSMUST00000202643]
Predicted Effect probably null
Transcript: ENSMUST00000060311
SMART Domains Protein: ENSMUSP00000059033
Gene: ENSMUSG00000039959

DomainStartEndE-ValueType
ENTH 38 160 9.98e-41 SMART
PDB:3I00|B 361 480 9e-57 PDB
Pfam:HIP1_clath_bdg 482 572 2.1e-27 PFAM
low complexity region 649 658 N/A INTRINSIC
low complexity region 780 796 N/A INTRINSIC
ILWEQ 806 1004 9.05e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201479
Predicted Effect probably null
Transcript: ENSMUST00000202643
SMART Domains Protein: ENSMUSP00000144086
Gene: ENSMUSG00000039959

DomainStartEndE-ValueType
PDB:2QA7|D 1 70 9e-34 PDB
Pfam:HIP1_clath_bdg 71 161 4.4e-24 PFAM
low complexity region 238 247 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
ILWEQ 395 593 5.7e-122 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that functions in clathrin-mediated endocytosis and protein trafficking within the cell. The encoded protein binds to the huntingtin protein in the brain; this interaction is lost in Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutants may exhibit axial skeleton defects, hematopotietic abnormalities, and testicular degeneration with increased apoptosis of postmeiotic spermatids. One line showed microphthalmia and cataracts, whereas others did not. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Hip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Hip1 APN 5 135449822 missense probably damaging 1.00
IGL00418:Hip1 APN 5 135426346 missense probably damaging 1.00
IGL01744:Hip1 APN 5 135545063 utr 5 prime probably benign
IGL02494:Hip1 APN 5 135444791 nonsense probably null
IGL02749:Hip1 APN 5 135444751 missense probably benign 0.00
IGL03219:Hip1 APN 5 135457050 missense probably benign 0.16
IGL03328:Hip1 APN 5 135424874 missense probably damaging 1.00
BB010:Hip1 UTSW 5 135460456 missense probably damaging 0.98
BB020:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0100:Hip1 UTSW 5 135436453 missense probably benign
R0336:Hip1 UTSW 5 135428613 missense probably benign 0.39
R0410:Hip1 UTSW 5 135458155 missense probably damaging 1.00
R1454:Hip1 UTSW 5 135438632 missense probably benign
R1530:Hip1 UTSW 5 135444780 missense probably damaging 1.00
R1848:Hip1 UTSW 5 135435141 splice site probably null
R2201:Hip1 UTSW 5 135431730 missense probably benign
R2246:Hip1 UTSW 5 135452844 missense probably damaging 1.00
R2276:Hip1 UTSW 5 135457046 missense probably damaging 1.00
R2353:Hip1 UTSW 5 135412712 missense probably damaging 1.00
R3013:Hip1 UTSW 5 135435039 missense possibly damaging 0.91
R3413:Hip1 UTSW 5 135422172 missense probably damaging 1.00
R3939:Hip1 UTSW 5 135428764 missense probably benign 0.14
R4153:Hip1 UTSW 5 135412706 missense probably damaging 1.00
R4839:Hip1 UTSW 5 135426318 splice site probably null
R5059:Hip1 UTSW 5 135449821 missense probably damaging 1.00
R5171:Hip1 UTSW 5 135440302 missense probably damaging 1.00
R5189:Hip1 UTSW 5 135434293 missense probably damaging 1.00
R5358:Hip1 UTSW 5 135436398 missense probably benign 0.22
R5642:Hip1 UTSW 5 135433085 nonsense probably null
R5646:Hip1 UTSW 5 135428741 missense probably damaging 0.98
R5831:Hip1 UTSW 5 135411263 missense probably benign 0.00
R5908:Hip1 UTSW 5 135424863 critical splice donor site probably null
R6484:Hip1 UTSW 5 135440129 missense probably damaging 1.00
R6557:Hip1 UTSW 5 135428719 missense possibly damaging 0.67
R7459:Hip1 UTSW 5 135414297 missense probably damaging 1.00
R7589:Hip1 UTSW 5 135414311 missense probably benign
R7677:Hip1 UTSW 5 135430317 missense probably benign
R7933:Hip1 UTSW 5 135460456 missense probably damaging 0.98
R8267:Hip1 UTSW 5 135428613 missense probably benign 0.39
Z1177:Hip1 UTSW 5 135428606 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTAGCATTCGTACTTGAAA -3'
(R):5'- CAGGCAGTGTTTAAACATCTGTCT -3'

Sequencing Primer
(F):5'- ACACACTCACTTTCTGGGTAGACATG -3'
(R):5'- AGTGTTTAAACATCTGTCTCTCCTG -3'
Posted On2018-06-06