Mutagenetix > Incidental Mutations

Incidental Mutation 'R6473:Ptgfrn'

520328

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6473 (G1)

Quality Score

176.009

Status

Validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 101045639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 760 (R760G)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably damaging
Transcript: ENSMUST00000102694
AA Change: R760G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: R760G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Meta Mutation Damage Score

0.6133

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 96.9%
20x: 89.9%

Validation Efficiency

95% (36/38)

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	T	C	16: 85,799,643	D106G	probably damaging	Het
Adat3	A	G	10: 80,606,967	D213G	probably damaging	Het
Akt1	T	C	12: 112,662,260	D32G	probably damaging	Het
Ampd1	C	T	3: 103,095,646	R61*	probably null	Het
Ash2l	T	A	8: 25,834,980	T184S	probably damaging	Het
B3galnt1	T	C	3: 69,575,340	N196S	possibly damaging	Het
Chmp2b	C	T	16: 65,546,872	G96S	probably damaging	Het
Cyp2d26	T	C	15: 82,791,767	N248S	probably benign	Het
Cyp46a1	G	T	12: 108,355,475	R320L	possibly damaging	Het
Dact1	A	G	12: 71,317,698	T418A	probably benign	Het
Ddx3y	T	C	Y: 1,265,971	Y342C	possibly damaging	Homo
Dnm3	T	A	1: 162,477,705	Q40L	probably damaging	Het
Eif2s1	T	C	12: 78,881,225	I225T	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Eps8	A	T	6: 137,479,098	I795N	probably damaging	Het
Fan1	T	A	7: 64,372,486	N340Y	probably damaging	Het
Fbxw7	T	C	3: 84,952,380		probably benign	Het
Gba	C	T	3: 89,204,081	P51L	probably benign	Het
Idh3b	AG	AGCACCACAACTG	2: 130,279,673		probably null	Het
Kalrn	A	G	16: 34,205,302	I551T	probably damaging	Het
Madd	T	C	2: 91,167,059	T755A	probably benign	Het
Mrps31	A	G	8: 22,414,865	D90G	probably benign	Het
Olfr115	T	A	17: 37,609,996	T252S	possibly damaging	Het
Olfr191	A	T	16: 59,086,043	L147M	probably benign	Het
P2ry12	T	A	3: 59,217,511	I248F	probably benign	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908		probably benign	Homo
Slpi	T	C	2: 164,354,926	Y116C	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Terb1	T	A	8: 104,473,037	E425V	probably damaging	Het
Thbs2	A	G	17: 14,685,796	S281P	probably benign	Het
Tnik	A	G	3: 28,263,643	M1V	probably null	Het
Usp16	G	A	16: 87,483,135	S741N	probably benign	Het
Usp48	T	C	4: 137,609,108		probably null	Het
Vipr1	T	C	9: 121,668,555	S380P	probably damaging	Het
Vmn1r21	A	T	6: 57,843,598	I287K	probably damaging	Het
Zfp157	T	C	5: 138,455,926	C129R	probably damaging	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACAGTTATAAAGATGGGCCTGG -3'
(R):5'- TACAGAACAGACCTGGCCAG -3'

Sequencing Primer
(F):5'- TTATAAAGATGGGCCTGGAGTGGATC -3'
(R):5'- CGTGTAAGGGTTGCACACAC -3'

Posted On

2018-06-06