Incidental Mutation 'R6535:Sbk3'
ID520329
Institutional Source Beutler Lab
Gene Symbol Sbk3
Ensembl Gene ENSMUSG00000085272
Gene NameSH3 domain binding kinase family, member 3
SynonymsLOC381835, Gm1078
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4965260-4971168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4969841 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 110 (M110R)
Ref Sequence ENSEMBL: ENSMUSP00000122507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133272] [ENSMUST00000144863]
Predicted Effect possibly damaging
Transcript: ENSMUST00000133272
AA Change: M129R

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120654
Gene: ENSMUSG00000085272
AA Change: M129R

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 43 268 1.8e-17 PFAM
Pfam:Pkinase 43 304 1.7e-30 PFAM
Pfam:Kinase-like 130 262 1.6e-8 PFAM
low complexity region 309 321 N/A INTRINSIC
low complexity region 328 347 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000144863
AA Change: M110R

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122507
Gene: ENSMUSG00000085272
AA Change: M110R

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 24 248 3.1e-17 PFAM
Pfam:Pkinase 24 284 5.6e-32 PFAM
Pfam:Kinase-like 111 237 2.5e-7 PFAM
low complexity region 290 302 N/A INTRINSIC
low complexity region 309 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Sbk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0002:Sbk3 UTSW 7 4970631 missense probably damaging 1.00
R0344:Sbk3 UTSW 7 4967405 missense possibly damaging 0.53
R1396:Sbk3 UTSW 7 4967453 missense possibly damaging 0.86
R2115:Sbk3 UTSW 7 4967416 missense possibly damaging 0.86
R4073:Sbk3 UTSW 7 4970502 missense probably damaging 1.00
R4298:Sbk3 UTSW 7 4969980 missense probably benign 0.05
R5347:Sbk3 UTSW 7 4967423 missense probably benign 0.18
R5819:Sbk3 UTSW 7 4969997 missense probably benign 0.38
R6957:Sbk3 UTSW 7 4967523 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCTCGAAGCTGTATACAC -3'
(R):5'- AACTGTGGCCCTTAAGCTCC -3'

Sequencing Primer
(F):5'- TCCTAGCTTGCGTTTGGAC -3'
(R):5'- GCCCTTAAGCTCCTCCGAAG -3'
Posted On2018-06-06