Incidental Mutation 'R6535:Wrn'
ID520335
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene NameWerner syndrome RecQ like helicase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location33234384-33385527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33336103 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 177 (H177R)
Ref Sequence ENSEMBL: ENSMUSP00000033991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991]
Predicted Effect probably damaging
Transcript: ENSMUST00000033990
AA Change: H177R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: H177R

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000033991
AA Change: H177R

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: H177R

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209293
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33322377 splice site probably benign
IGL00661:Wrn APN 8 33319145 splice site probably benign
IGL01472:Wrn APN 8 33329172 missense possibly damaging 0.93
IGL01544:Wrn APN 8 33324526 missense probably benign 0.00
IGL01599:Wrn APN 8 33241011 missense possibly damaging 0.69
IGL01688:Wrn APN 8 33310702 splice site probably benign
IGL01916:Wrn APN 8 33257224 missense possibly damaging 0.78
IGL01925:Wrn APN 8 33319180 missense probably benign 0.42
IGL02068:Wrn APN 8 33310749 missense probably benign 0.38
IGL02084:Wrn APN 8 33285179 missense probably benign
IGL02167:Wrn APN 8 33317555 missense probably damaging 1.00
IGL02230:Wrn APN 8 33317563 missense probably damaging 1.00
IGL02717:Wrn APN 8 33343573 missense probably damaging 1.00
IGL02982:Wrn APN 8 33343066 missense probably damaging 1.00
IGL03030:Wrn APN 8 33248961 missense possibly damaging 0.94
IGL03088:Wrn APN 8 33268823 splice site probably benign
IGL03179:Wrn APN 8 33310706 splice site probably null
IGL03306:Wrn APN 8 33336121 missense probably damaging 1.00
R0004:Wrn UTSW 8 33317560 missense probably damaging 1.00
R0190:Wrn UTSW 8 33240983 missense probably benign 0.02
R0441:Wrn UTSW 8 33268750 missense probably benign 0.24
R0463:Wrn UTSW 8 33280815 missense possibly damaging 0.84
R0538:Wrn UTSW 8 33336091 missense probably damaging 0.99
R0682:Wrn UTSW 8 33267820 missense probably benign 0.00
R0729:Wrn UTSW 8 33248918 splice site probably null
R0744:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R0836:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R1168:Wrn UTSW 8 33316408 missense probably damaging 1.00
R1301:Wrn UTSW 8 33292686 missense probably damaging 1.00
R1352:Wrn UTSW 8 33294916 missense probably benign 0.25
R1396:Wrn UTSW 8 33268819 missense probably damaging 1.00
R1432:Wrn UTSW 8 33319141 splice site probably benign
R1523:Wrn UTSW 8 33292716 missense probably benign 0.23
R1625:Wrn UTSW 8 33329130 missense probably benign 0.01
R1664:Wrn UTSW 8 33280766 splice site probably null
R1773:Wrn UTSW 8 33343561 missense probably damaging 1.00
R1864:Wrn UTSW 8 33288864 missense probably damaging 0.99
R1868:Wrn UTSW 8 33257221 missense probably benign 0.03
R2011:Wrn UTSW 8 33236404 missense probably benign 0.02
R2075:Wrn UTSW 8 33322329 missense probably benign 0.00
R2091:Wrn UTSW 8 33267825 missense probably benign
R2213:Wrn UTSW 8 33257015 missense probably benign 0.05
R2255:Wrn UTSW 8 33329202 missense probably benign 0.13
R2276:Wrn UTSW 8 33324556 missense probably benign 0.02
R3177:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3277:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3779:Wrn UTSW 8 33241020 missense probably damaging 1.00
R3827:Wrn UTSW 8 33324520 missense probably benign 0.00
R4111:Wrn UTSW 8 33352155 missense probably benign 0.02
R4392:Wrn UTSW 8 33251832 missense probably damaging 0.99
R4458:Wrn UTSW 8 33294998 missense probably damaging 0.99
R4650:Wrn UTSW 8 33255509 missense probably benign 0.05
R4656:Wrn UTSW 8 33335991 splice site probably null
R4657:Wrn UTSW 8 33335991 splice site probably null
R4667:Wrn UTSW 8 33324338 missense probably benign 0.00
R4735:Wrn UTSW 8 33285222 missense probably damaging 1.00
R4933:Wrn UTSW 8 33322343 missense probably benign 0.01
R5104:Wrn UTSW 8 33267867 splice site probably null
R5166:Wrn UTSW 8 33352072 critical splice donor site probably null
R5279:Wrn UTSW 8 33241101 missense probably damaging 1.00
R5400:Wrn UTSW 8 33294917 missense probably benign 0.02
R5575:Wrn UTSW 8 33336130 missense probably benign 0.02
R5695:Wrn UTSW 8 33324318 missense probably benign 0.26
R5729:Wrn UTSW 8 33268778 missense probably benign 0.02
R6044:Wrn UTSW 8 33236429 missense probably damaging 1.00
R6139:Wrn UTSW 8 33353332 missense probably damaging 1.00
R6158:Wrn UTSW 8 33319172 missense probably damaging 1.00
R6192:Wrn UTSW 8 33284654 missense probably benign 0.12
R6243:Wrn UTSW 8 33284654 missense possibly damaging 0.94
R6354:Wrn UTSW 8 33343638 missense possibly damaging 0.93
R6429:Wrn UTSW 8 33342996 missense probably damaging 1.00
R6490:Wrn UTSW 8 33319220 missense probably benign 0.01
R6529:Wrn UTSW 8 33335976 splice site probably null
R7001:Wrn UTSW 8 33352129 missense probably benign 0.04
R7114:Wrn UTSW 8 33285121 frame shift probably null
R7198:Wrn UTSW 8 33324318 missense probably benign 0.00
R7200:Wrn UTSW 8 33322348 missense probably benign 0.00
R7227:Wrn UTSW 8 33248946 missense probably damaging 1.00
R7299:Wrn UTSW 8 33292718 missense probably damaging 1.00
R7374:Wrn UTSW 8 33268911 missense probably damaging 1.00
R7402:Wrn UTSW 8 33248966 missense probably benign 0.00
R7404:Wrn UTSW 8 33248966 missense probably benign 0.00
R7405:Wrn UTSW 8 33248966 missense probably benign 0.00
R7464:Wrn UTSW 8 33335996 critical splice donor site probably null
R7474:Wrn UTSW 8 33329181 missense probably damaging 0.96
R7609:Wrn UTSW 8 33310713 missense possibly damaging 0.50
R7729:Wrn UTSW 8 33324426 missense probably benign 0.21
R7830:Wrn UTSW 8 33269054 missense probably damaging 0.97
R7998:Wrn UTSW 8 33292643 missense probably benign 0.10
R8239:Wrn UTSW 8 33329185 missense probably damaging 1.00
R8262:Wrn UTSW 8 33324246 missense probably benign 0.07
R8410:Wrn UTSW 8 33269020 missense probably damaging 1.00
RF010:Wrn UTSW 8 33288765 missense probably benign 0.13
X0017:Wrn UTSW 8 33280782 missense probably damaging 1.00
Z1176:Wrn UTSW 8 33334209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATATTTCAGCTAAGGACATAACCCC -3'
(R):5'- GCCCTTTGATACCCACATTATG -3'

Sequencing Primer
(F):5'- AGGACATAACCCCAATACATTTTTAC -3'
(R):5'- GGAACCTCGGAGTTAAATTCCTACTG -3'
Posted On2018-06-06