Incidental Mutation 'R6535:Mipol1'
ID520343
Institutional Source Beutler Lab
Gene Symbol Mipol1
Ensembl Gene ENSMUSG00000047022
Gene Namemirror-image polydactyly 1
Synonyms1700081O04Rik, 6030439O22Rik, D12Ertd19e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location57230427-57497199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 57306100 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 75 (Q75P)
Ref Sequence ENSEMBL: ENSMUSP00000117005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123498] [ENSMUST00000130447] [ENSMUST00000145003] [ENSMUST00000153137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000123498
AA Change: Q75P

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119636
Gene: ENSMUSG00000047022
AA Change: Q75P

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000130447
AA Change: Q75P

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119918
Gene: ENSMUSG00000047022
AA Change: Q75P

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136006
Predicted Effect possibly damaging
Transcript: ENSMUST00000145003
AA Change: Q75P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121617
Gene: ENSMUSG00000047022
AA Change: Q75P

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150292
Predicted Effect possibly damaging
Transcript: ENSMUST00000153137
AA Change: Q75P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117005
Gene: ENSMUSG00000047022
AA Change: Q75P

DomainStartEndE-ValueType
coiled coil region 70 127 N/A INTRINSIC
Blast:HNHc 220 265 2e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153755
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein may function as a tumor suppressor. A translocation that results in truncation of the protein encoded by this locus has been associated with mirror-image polydactyly, also known as Laurin-Sandrow Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Mipol1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Mipol1 APN 12 57307353 splice site probably benign
IGL01139:Mipol1 APN 12 57306035 nonsense probably null
IGL02679:Mipol1 APN 12 57306043 missense possibly damaging 0.84
IGL03109:Mipol1 APN 12 57364224 missense probably benign 0.20
R0001:Mipol1 UTSW 12 57460839 splice site probably benign
R0220:Mipol1 UTSW 12 57457150 missense probably damaging 1.00
R0271:Mipol1 UTSW 12 57460954 unclassified probably benign
R0284:Mipol1 UTSW 12 57457069 missense probably damaging 0.98
R0496:Mipol1 UTSW 12 57457177 missense probably damaging 0.99
R0538:Mipol1 UTSW 12 57414411 critical splice donor site probably null
R1082:Mipol1 UTSW 12 57325616 missense probably damaging 0.98
R1552:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
R1558:Mipol1 UTSW 12 57332341 missense probably damaging 1.00
R1928:Mipol1 UTSW 12 57332419 missense probably damaging 1.00
R2104:Mipol1 UTSW 12 57306056 splice site probably null
R2495:Mipol1 UTSW 12 57460990 splice site probably benign
R3723:Mipol1 UTSW 12 57457092 missense probably damaging 1.00
R4431:Mipol1 UTSW 12 57303524 missense possibly damaging 0.58
R4447:Mipol1 UTSW 12 57352748 intron probably benign
R4654:Mipol1 UTSW 12 57306132 missense probably benign 0.22
R4847:Mipol1 UTSW 12 57303496 missense probably damaging 0.99
R4851:Mipol1 UTSW 12 57332301 missense probably damaging 1.00
R5113:Mipol1 UTSW 12 57496499 missense probably benign 0.36
R5668:Mipol1 UTSW 12 57325560 missense possibly damaging 0.48
R7172:Mipol1 UTSW 12 57325535 missense possibly damaging 0.95
R7191:Mipol1 UTSW 12 57457066 missense probably benign 0.01
R7560:Mipol1 UTSW 12 57306073 missense possibly damaging 0.94
R8508:Mipol1 UTSW 12 57306088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACCGGAGTCTCTTTTGGGATC -3'
(R):5'- CTAAATCATACCTGGATGACAAAGC -3'

Sequencing Primer
(F):5'- TCCCATTGTAAATTGATATCTGTACG -3'
(R):5'- TCATACCTGGATGACAAAGCAACAC -3'
Posted On2018-06-06