Incidental Mutation 'R6473:Ash2l'
ID520346
Institutional Source Beutler Lab
Gene Symbol Ash2l
Ensembl Gene ENSMUSG00000031575
Gene NameASH2 like histone lysine methyltransferase complex subunit
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6473 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25815996-25847694 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25834980 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 184 (T184S)
Ref Sequence ENSEMBL: ENSMUSP00000117488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068892] [ENSMUST00000110608] [ENSMUST00000110609] [ENSMUST00000110610] [ENSMUST00000139946] [ENSMUST00000151856] [ENSMUST00000166078]
Predicted Effect probably damaging
Transcript: ENSMUST00000068892
AA Change: T184S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000070957
Gene: ENSMUSG00000031575
AA Change: T184S

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-136 PDB
Blast:PHD 103 146 2e-6 BLAST
low complexity region 280 306 N/A INTRINSIC
SPRY 413 577 4.87e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110608
AA Change: T95S

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106238
Gene: ENSMUSG00000031575
AA Change: T95S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 455 1.13e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110609
AA Change: T95S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106239
Gene: ENSMUSG00000031575
AA Change: T95S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110610
AA Change: T95S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106240
Gene: ENSMUSG00000031575
AA Change: T95S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139946
AA Change: T184S

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118346
Gene: ENSMUSG00000031575
AA Change: T184S

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 275 1e-141 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 278 300 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151856
AA Change: T184S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117488
Gene: ENSMUSG00000031575
AA Change: T184S

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
low complexity region 36 59 N/A INTRINSIC
PDB:3S32|A 90 272 1e-125 PDB
Blast:PHD 103 146 1e-6 BLAST
transmembrane domain 286 305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166078
AA Change: T95S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000132546
Gene: ENSMUSG00000031575
AA Change: T95S

DomainStartEndE-ValueType
PDB:3S32|A 1 186 1e-137 PDB
Blast:PHD 14 57 2e-6 BLAST
low complexity region 191 217 N/A INTRINSIC
SPRY 324 488 4.87e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211188
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele die before E8.5-E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,799,643 D106G probably damaging Het
Adat3 A G 10: 80,606,967 D213G probably damaging Het
Akt1 T C 12: 112,662,260 D32G probably damaging Het
Ampd1 C T 3: 103,095,646 R61* probably null Het
B3galnt1 T C 3: 69,575,340 N196S possibly damaging Het
Chmp2b C T 16: 65,546,872 G96S probably damaging Het
Cyp2d26 T C 15: 82,791,767 N248S probably benign Het
Cyp46a1 G T 12: 108,355,475 R320L possibly damaging Het
Dact1 A G 12: 71,317,698 T418A probably benign Het
Ddx3y T C Y: 1,265,971 Y342C possibly damaging Homo
Dnm3 T A 1: 162,477,705 Q40L probably damaging Het
Eif2s1 T C 12: 78,881,225 I225T probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Eps8 A T 6: 137,479,098 I795N probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw7 T C 3: 84,952,380 probably benign Het
Gba C T 3: 89,204,081 P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Kalrn A G 16: 34,205,302 I551T probably damaging Het
Madd T C 2: 91,167,059 T755A probably benign Het
Mrps31 A G 8: 22,414,865 D90G probably benign Het
Olfr115 T A 17: 37,609,996 T252S possibly damaging Het
Olfr191 A T 16: 59,086,043 L147M probably benign Het
P2ry12 T A 3: 59,217,511 I248F probably benign Het
Ptgfrn T C 3: 101,045,639 R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Slpi T C 2: 164,354,926 Y116C probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Terb1 T A 8: 104,473,037 E425V probably damaging Het
Thbs2 A G 17: 14,685,796 S281P probably benign Het
Tnik A G 3: 28,263,643 M1V probably null Het
Usp16 G A 16: 87,483,135 S741N probably benign Het
Usp48 T C 4: 137,609,108 probably null Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Vmn1r21 A T 6: 57,843,598 I287K probably damaging Het
Zfp157 T C 5: 138,455,926 C129R probably damaging Het
Other mutations in Ash2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01835:Ash2l APN 8 25839840 missense probably damaging 1.00
IGL01913:Ash2l APN 8 25819624 critical splice donor site probably null
IGL02379:Ash2l APN 8 25822771 missense probably damaging 1.00
IGL03149:Ash2l APN 8 25818622 missense probably benign 0.00
R0639:Ash2l UTSW 8 25823291 missense possibly damaging 0.83
R1217:Ash2l UTSW 8 25822885 missense probably damaging 0.97
R1244:Ash2l UTSW 8 25817421 missense probably damaging 0.99
R1440:Ash2l UTSW 8 25827378 missense probably benign 0.27
R2282:Ash2l UTSW 8 25835042 missense probably damaging 0.99
R3013:Ash2l UTSW 8 25839764 missense probably damaging 0.96
R3721:Ash2l UTSW 8 25818625 missense probably damaging 1.00
R4155:Ash2l UTSW 8 25817454 missense probably damaging 1.00
R4727:Ash2l UTSW 8 25818595 missense probably damaging 0.99
R5637:Ash2l UTSW 8 25827311 missense probably damaging 1.00
R5973:Ash2l UTSW 8 25817614 missense possibly damaging 0.93
R6678:Ash2l UTSW 8 25833777 missense probably damaging 1.00
R6710:Ash2l UTSW 8 25819712 missense possibly damaging 0.63
R6954:Ash2l UTSW 8 25822768 missense possibly damaging 0.52
R7166:Ash2l UTSW 8 25827320 missense probably damaging 1.00
R7266:Ash2l UTSW 8 25827205 nonsense probably null
R7483:Ash2l UTSW 8 25822770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTGATAATACTAAGAGCTAAGCC -3'
(R):5'- GCTTCACAGTGTGCACATG -3'

Sequencing Primer
(F):5'- GAGCTAAGCCAAATGACATCTAC -3'
(R):5'- CAGTGTGCACATGACAGTTC -3'
Posted On2018-06-06