Incidental Mutation 'R6535:Gm20767'
ID520347
Institutional Source Beutler Lab
Gene Symbol Gm20767
Ensembl Gene ENSMUSG00000096323
Gene Namepredicted gene, 20767
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location120140246-120155335 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120154654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 10 (S10P)
Ref Sequence ENSEMBL: ENSMUSP00000152988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179071] [ENSMUST00000225683]
Predicted Effect probably damaging
Transcript: ENSMUST00000179071
AA Change: S10P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137504
Gene: ENSMUSG00000096323
AA Change: S10P

DomainStartEndE-ValueType
Pfam:DUF1438 7 155 3.2e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224202
Predicted Effect probably damaging
Transcript: ENSMUST00000225683
AA Change: S10P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Gm20767
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1004:Gm20767 UTSW 13 120155022 missense probably benign 0.00
R3753:Gm20767 UTSW 13 120154631 missense possibly damaging 0.56
R3930:Gm20767 UTSW 13 120154832 missense probably damaging 0.98
R4873:Gm20767 UTSW 13 120154670 missense probably damaging 0.98
R4875:Gm20767 UTSW 13 120154670 missense probably damaging 0.98
R5020:Gm20767 UTSW 13 120155116 missense possibly damaging 0.85
R5599:Gm20767 UTSW 13 120154922 missense probably damaging 0.99
R5802:Gm20767 UTSW 13 120154913 missense possibly damaging 0.93
R6469:Gm20767 UTSW 13 120154813 missense probably damaging 1.00
R7543:Gm20767 UTSW 13 120154754 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAATCGTGTCTCCTTAGGC -3'
(R):5'- AGGATCTCAGGTAGTCCACAC -3'

Sequencing Primer
(F):5'- GTCTCCTTAGGCACTGCAAATAG -3'
(R):5'- TCAGGTAGTCCACACTCTCAAATAC -3'
Posted On2018-06-06