Incidental Mutation 'R6535:Fam135b'
ID520351
Institutional Source Beutler Lab
Gene Symbol Fam135b
Ensembl Gene ENSMUSG00000036800
Gene Namefamily with sequence similarity 135, member B
Synonyms1700010C24Rik, A830008O07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location71431609-71727838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71622075 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2 (S2P)
Ref Sequence ENSEMBL: ENSMUSP00000022953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022953] [ENSMUST00000229189]
Predicted Effect probably damaging
Transcript: ENSMUST00000022953
AA Change: S2P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022953
Gene: ENSMUSG00000036800
AA Change: S2P

DomainStartEndE-ValueType
Pfam:DUF3657 111 172 1.9e-19 PFAM
low complexity region 744 757 N/A INTRINSIC
low complexity region 1124 1130 N/A INTRINSIC
Pfam:DUF676 1132 1328 2.7e-60 PFAM
Pfam:PGAP1 1135 1309 3.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229189
AA Change: S2P

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230569
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Fam135b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Fam135b APN 15 71450494 missense probably damaging 1.00
IGL00565:Fam135b APN 15 71471512 missense probably benign
IGL00645:Fam135b APN 15 71462546 missense probably damaging 1.00
IGL00686:Fam135b APN 15 71462319 missense probably benign 0.00
IGL00857:Fam135b APN 15 71463616 missense probably benign 0.16
IGL01443:Fam135b APN 15 71463364 missense probably benign 0.02
IGL01690:Fam135b APN 15 71456935 missense probably benign 0.19
IGL01920:Fam135b APN 15 71622036 missense possibly damaging 0.94
IGL01987:Fam135b APN 15 71462115 missense probably benign
IGL02154:Fam135b APN 15 71448710 missense probably benign 0.12
IGL03107:Fam135b APN 15 71463561 missense probably benign
IGL03264:Fam135b APN 15 71462788 missense probably benign
IGL03055:Fam135b UTSW 15 71622034 missense possibly damaging 0.51
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0010:Fam135b UTSW 15 71622032 missense probably damaging 1.00
R0230:Fam135b UTSW 15 71446037 missense probably benign 0.02
R0413:Fam135b UTSW 15 71463821 missense probably benign 0.45
R0524:Fam135b UTSW 15 71462284 missense probably benign 0.00
R0565:Fam135b UTSW 15 71490837 missense possibly damaging 0.88
R0628:Fam135b UTSW 15 71448656 splice site probably benign
R1415:Fam135b UTSW 15 71456928 missense probably damaging 0.99
R1462:Fam135b UTSW 15 71621996 splice site probably benign
R1701:Fam135b UTSW 15 71459729 missense probably damaging 1.00
R1797:Fam135b UTSW 15 71452441 missense probably benign 0.41
R1807:Fam135b UTSW 15 71463912 missense probably benign
R1835:Fam135b UTSW 15 71490711 missense probably damaging 1.00
R1905:Fam135b UTSW 15 71532987 missense probably damaging 1.00
R1937:Fam135b UTSW 15 71622014 missense probably damaging 1.00
R1998:Fam135b UTSW 15 71452404 missense probably damaging 0.98
R2076:Fam135b UTSW 15 71478243 missense probably damaging 0.99
R2518:Fam135b UTSW 15 71463911 missense probably benign 0.00
R3110:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3112:Fam135b UTSW 15 71464030 missense probably benign 0.05
R3932:Fam135b UTSW 15 71450431 missense probably benign 0.29
R4361:Fam135b UTSW 15 71490827 missense probably damaging 1.00
R4397:Fam135b UTSW 15 71448676 missense probably benign 0.17
R4435:Fam135b UTSW 15 71448739 missense probably damaging 1.00
R4645:Fam135b UTSW 15 71462340 missense probably benign
R4740:Fam135b UTSW 15 71464071 missense probably benign 0.01
R4748:Fam135b UTSW 15 71464055 missense probably benign 0.00
R4754:Fam135b UTSW 15 71462951 missense probably benign 0.01
R5044:Fam135b UTSW 15 71462711 missense probably benign 0.02
R5469:Fam135b UTSW 15 71446043 missense probably benign 0.16
R5617:Fam135b UTSW 15 71622016 missense probably damaging 1.00
R5642:Fam135b UTSW 15 71462136 missense probably damaging 1.00
R5778:Fam135b UTSW 15 71479032 missense probably damaging 1.00
R5891:Fam135b UTSW 15 71525803 missense probably damaging 1.00
R5958:Fam135b UTSW 15 71462895 missense probably benign 0.01
R5982:Fam135b UTSW 15 71448669 critical splice donor site probably null
R5987:Fam135b UTSW 15 71490848 missense probably benign 0.00
R6734:Fam135b UTSW 15 71462780 missense probably benign 0.02
R6887:Fam135b UTSW 15 71463315 missense probably damaging 1.00
R7028:Fam135b UTSW 15 71471563 missense probably damaging 1.00
R7035:Fam135b UTSW 15 71462253 missense possibly damaging 0.77
R7097:Fam135b UTSW 15 71622068 missense possibly damaging 0.92
R7143:Fam135b UTSW 15 71479151 missense probably benign 0.44
R7414:Fam135b UTSW 15 71478256 missense probably damaging 0.97
R7439:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7441:Fam135b UTSW 15 71463680 missense probably damaging 0.98
R7545:Fam135b UTSW 15 71450510 missense possibly damaging 0.95
R7615:Fam135b UTSW 15 71463323 missense probably damaging 1.00
R7642:Fam135b UTSW 15 71479142 missense possibly damaging 0.51
R7649:Fam135b UTSW 15 71462580 missense probably benign 0.00
R7686:Fam135b UTSW 15 71463384 missense possibly damaging 0.68
R7866:Fam135b UTSW 15 71462076 missense probably benign 0.00
R7949:Fam135b UTSW 15 71462076 missense probably benign 0.00
R8006:Fam135b UTSW 15 71462334 missense probably benign 0.00
R8068:Fam135b UTSW 15 71532978 missense probably damaging 1.00
T0722:Fam135b UTSW 15 71463885 missense probably damaging 1.00
T0975:Fam135b UTSW 15 71463885 missense probably damaging 1.00
Z1177:Fam135b UTSW 15 71622076 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- GGGATGAAGGAAATTAGCTCTTAGTC -3'
(R):5'- GAAGCAGAACACGGTGTTGC -3'

Sequencing Primer
(F):5'- GAAGGAAATTAGCTCTTAGTCAATGC -3'
(R):5'- CAGAACACGGTGTTGCATTGGTC -3'
Posted On2018-06-06