Incidental Mutation 'R6535:Dennd6b'
ID520357
Institutional Source Beutler Lab
Gene Symbol Dennd6b
Ensembl Gene ENSMUSG00000015377
Gene NameDENN/MADD domain containing 6B
SynonymsFam116b, 1700027J05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89182213-89196496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89186367 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 400 (L400P)
Ref Sequence ENSEMBL: ENSMUSP00000077978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078953] [ENSMUST00000229755]
Predicted Effect probably damaging
Transcript: ENSMUST00000078953
AA Change: L400P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077978
Gene: ENSMUSG00000015377
AA Change: L400P

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Avl9 42 181 1.1e-8 PFAM
Pfam:DENN 148 344 1.2e-8 PFAM
Pfam:SPA 248 358 6.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229416
Predicted Effect probably benign
Transcript: ENSMUST00000229755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230823
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Dennd6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02709:Dennd6b APN 15 89190922 splice site probably benign
IGL03109:Dennd6b APN 15 89184985 utr 3 prime probably benign
IGL03133:Dennd6b APN 15 89188523 critical splice acceptor site probably null
P0016:Dennd6b UTSW 15 89186977 missense probably benign
PIT4791001:Dennd6b UTSW 15 89186752 critical splice donor site probably null
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0268:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0344:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0391:Dennd6b UTSW 15 89187214 missense probably damaging 1.00
R1453:Dennd6b UTSW 15 89188872 missense probably damaging 0.99
R1655:Dennd6b UTSW 15 89196340 missense unknown
R1670:Dennd6b UTSW 15 89185337 intron probably benign
R1765:Dennd6b UTSW 15 89190303 nonsense probably null
R1968:Dennd6b UTSW 15 89190341 missense possibly damaging 0.63
R3692:Dennd6b UTSW 15 89186827 splice site probably benign
R4344:Dennd6b UTSW 15 89188663 missense probably benign 0.00
R4736:Dennd6b UTSW 15 89185592 missense probably benign 0.00
R5030:Dennd6b UTSW 15 89196251 missense possibly damaging 0.82
R5058:Dennd6b UTSW 15 89187350 missense possibly damaging 0.69
R5509:Dennd6b UTSW 15 89185022 missense probably damaging 1.00
R6005:Dennd6b UTSW 15 89188168 missense possibly damaging 0.91
R6160:Dennd6b UTSW 15 89188821 missense probably damaging 0.97
R6646:Dennd6b UTSW 15 89186184 missense probably damaging 0.99
R7098:Dennd6b UTSW 15 89188687 missense probably damaging 1.00
R7169:Dennd6b UTSW 15 89188852 missense possibly damaging 0.80
R7381:Dennd6b UTSW 15 89186173 missense possibly damaging 0.84
R7706:Dennd6b UTSW 15 89185244 missense probably benign 0.19
R8070:Dennd6b UTSW 15 89185373 missense probably benign 0.29
X0063:Dennd6b UTSW 15 89185420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGAGCTCTAGAAGGTGCC -3'
(R):5'- CTTTAGCAGGTCCCTTGAGTC -3'

Sequencing Primer
(F):5'- AGGTGCCGCCTCAGCAG -3'
(R):5'- CAGGTCCCTTGAGTCTCAGGATG -3'
Posted On2018-06-06