Incidental Mutation 'R6535:Rhbdl1'
ID520363
Institutional Source Beutler Lab
Gene Symbol Rhbdl1
Ensembl Gene ENSMUSG00000025735
Gene Namerhomboid like 1
SynonymsRhbdl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25834465-25837295 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 25835825 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 111 (Y111*)
Ref Sequence ENSEMBL: ENSMUSP00000138927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000026832] [ENSMUST00000043897] [ENSMUST00000044911] [ENSMUST00000133595] [ENSMUST00000183929] [ENSMUST00000184865]
Predicted Effect probably null
Transcript: ENSMUST00000026831
AA Change: Y165*
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735
AA Change: Y165*

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043897
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044911
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176522
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect probably null
Transcript: ENSMUST00000183929
AA Change: Y169*
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735
AA Change: Y169*

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184865
AA Change: Y111*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to Rhomboid in Drosophila which is involved in signalling in the Spitz/epidermal growth factor receptor/mitogen-activated protein kinase pathway. The Rhomboid family of proteins consists of intramembrane serine proteases containing several transmembrane domains. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Rhbdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Rhbdl1 APN 17 25836138 missense possibly damaging 0.62
R1672:Rhbdl1 UTSW 17 25836409 critical splice donor site probably null
R1922:Rhbdl1 UTSW 17 25835539 missense probably damaging 1.00
R4976:Rhbdl1 UTSW 17 25835028 nonsense probably null
R5500:Rhbdl1 UTSW 17 25836554 missense possibly damaging 0.83
R6293:Rhbdl1 UTSW 17 25834969 missense probably damaging 1.00
R6296:Rhbdl1 UTSW 17 25834969 missense probably damaging 1.00
R6848:Rhbdl1 UTSW 17 25836184 nonsense probably null
R7619:Rhbdl1 UTSW 17 25837017 missense possibly damaging 0.85
R7721:Rhbdl1 UTSW 17 25836149 missense probably benign 0.10
R7746:Rhbdl1 UTSW 17 25836193 missense probably benign 0.06
R8015:Rhbdl1 UTSW 17 25835851 missense probably damaging 1.00
X0009:Rhbdl1 UTSW 17 25836409 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTAGCTGGGAGATAAGCCTTC -3'
(R):5'- TATGTGGCCTACGAGATCCTGC -3'

Sequencing Primer
(F):5'- TAAGCCTTCAGAGTCAGTGGGC -3'
(R):5'- TGGTACTTCTACAGGCACCG -3'
Posted On2018-06-06