Mutagenetix > Incidental Mutation

Incidental Mutation 'R6473:Kalrn'

520366

Institutional Source

Beutler Lab

Gene Symbol

Kalrn

Ensembl Gene

ENSMUSG00000061751

Gene Name

kalirin, RhoGEF kinase

Synonyms

2210407G14Rik, Hapip, E530005C20Rik, LOC224126

MMRRC Submission

044606-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.922) question?

Stock #

R6473 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

33969073-34573532 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34205302 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 551 (I551T)

Ref Sequence

ENSEMBL: ENSMUSP00000110604 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000076810
AA Change: I1165T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: I1165T

Domain	Start	End	E-Value	Type
SEC14	20	159	2.22e-30	SMART
SPEC	173	289	5.32e-9	SMART
SPEC	295	397	1.19e-11	SMART
SPEC	400	515	1.83e0	SMART
SPEC	521	623	9.84e-13	SMART
SPEC	626	748	2.74e-2	SMART
SPEC	875	976	8.11e-14	SMART
SPEC	1106	1208	4.7e-10	SMART
RhoGEF	1258	1428	3.6e-56	SMART
PH	1442	1555	5.24e-8	SMART
SH3	1622	1683	1.23e-7	SMART
RhoGEF	1904	2074	1.47e-52	SMART
PH	2094	2199	9.87e-4	SMART
SH3	2295	2356	2.78e-2	SMART
IGc2	2455	2527	4.28e-12	SMART
FN3	2541	2623	3.07e-11	SMART
S_TKc	2656	2910	1.28e-71	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000089655
AA Change: I1192T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: I1192T

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	1003	1.85e-8	SMART
SPEC	1133	1235	4.7e-10	SMART
RhoGEF	1285	1455	3.6e-56	SMART
PH	1469	1582	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114947
AA Change: I538T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: I538T

Domain	Start	End	E-Value	Type
SPEC	3	112	4.22e-3	SMART
internal_repeat_1	128	187	9.63e-6	PROSPERO
SPEC	239	349	1.85e-8	SMART
SPEC	479	581	4.7e-10	SMART
RhoGEF	631	801	3.6e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114949
AA Change: I542T

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: I542T

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	2.9e-5	PROSPERO
SPEC	252	353	8.11e-14	SMART
SPEC	483	585	4.7e-10	SMART
RhoGEF	635	805	3.6e-56	SMART
PH	819	932	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114953
AA Change: I551T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: I551T

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114954
AA Change: I551T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: I551T

Domain	Start	End	E-Value	Type
SPEC	3	125	2.74e-2	SMART
internal_repeat_1	141	204	4.18e-5	PROSPERO
coiled coil region	217	248	N/A	INTRINSIC
SPEC	252	362	1.85e-8	SMART
SPEC	492	594	4.7e-10	SMART
RhoGEF	644	814	3.6e-56	SMART
PH	828	941	5.24e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114960
AA Change: I1183T

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: I1183T

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
SEC14	38	177	2.22e-30	SMART
SPEC	191	307	5.32e-9	SMART
SPEC	313	415	1.19e-11	SMART
SPEC	418	533	1.83e0	SMART
SPEC	539	641	9.84e-13	SMART
SPEC	644	766	2.74e-2	SMART
SPEC	893	994	8.11e-14	SMART
SPEC	1124	1226	4.7e-10	SMART
RhoGEF	1276	1446	3.6e-56	SMART
PH	1460	1573	5.24e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114961

SMART Domains

Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

Domain	Start	End	E-Value	Type
SEC14	40	179	2.22e-30	SMART
SPEC	193	309	5.32e-9	SMART
SPEC	315	417	1.19e-11	SMART
SPEC	420	535	1.83e0	SMART
SPEC	541	643	9.84e-13	SMART
SPEC	646	768	2.74e-2	SMART
SPEC	895	996	8.11e-14	SMART
SPEC	1126	1228	4.7e-10	SMART
RhoGEF	1278	1448	3.6e-56	SMART
PH	1462	1575	5.24e-8	SMART
SH3	1642	1703	1.23e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000142817
AA Change: I1160T

SMART Domains

Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: I1160T

Domain	Start	End	E-Value	Type
SEC14	16	155	2.22e-30	SMART
SPEC	169	285	5.32e-9	SMART
SPEC	291	393	1.19e-11	SMART
SPEC	396	511	1.83e0	SMART
SPEC	517	619	9.84e-13	SMART
SPEC	622	744	2.74e-2	SMART
SPEC	871	972	8.11e-14	SMART
SPEC	1102	1204	4.7e-10	SMART
RhoGEF	1254	1424	3.6e-56	SMART
PH	1438	1551	5.24e-8	SMART
SH3	1618	1679	1.23e-7	SMART
RhoGEF	1900	2070	1.47e-52	SMART
PH	2090	2195	9.87e-4	SMART
SH3	2291	2352	2.78e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151491
AA Change: I939T

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: I939T

Domain	Start	End	E-Value	Type
SEC14	26	165	2.22e-30	SMART
SPEC	179	295	5.32e-9	SMART
SPEC	301	403	1.19e-11	SMART
SPEC	640	750	1.85e-8	SMART
SPEC	880	982	4.7e-10	SMART
RhoGEF	1032	1202	3.6e-56	SMART
PH	1216	1329	5.24e-8	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 96.9%
20x: 89.9%

Validation Efficiency

95% (36/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts1	T	C	16: 85,799,643 (GRCm38)	D106G	probably damaging	Het
Adat3	A	G	10: 80,606,967 (GRCm38)	D213G	probably damaging	Het
Akt1	T	C	12: 112,662,260 (GRCm38)	D32G	probably damaging	Het
Ampd1	C	T	3: 103,095,646 (GRCm38)	R61*	probably null	Het
Ash2l	T	A	8: 25,834,980 (GRCm38)	T184S	probably damaging	Het
B3galnt1	T	C	3: 69,575,340 (GRCm38)	N196S	possibly damaging	Het
Chmp2b	C	T	16: 65,546,872 (GRCm38)	G96S	probably damaging	Het
Cyp2d26	T	C	15: 82,791,767 (GRCm38)	N248S	probably benign	Het
Cyp46a1	G	T	12: 108,355,475 (GRCm38)	R320L	possibly damaging	Het
Dact1	A	G	12: 71,317,698 (GRCm38)	T418A	probably benign	Het
Ddx3y	T	C	Y: 1,265,971 (GRCm38)	Y342C	possibly damaging	Homo
Dnm3	T	A	1: 162,477,705 (GRCm38)	Q40L	probably damaging	Het
Eif2s1	T	C	12: 78,881,225 (GRCm38)	I225T	probably damaging	Het
Enpp5	G	A	17: 44,085,264 (GRCm38)	G356S	probably damaging	Het
Eps8	A	T	6: 137,479,098 (GRCm38)	I795N	probably damaging	Het
Fan1	T	A	7: 64,372,486 (GRCm38)	N340Y	probably damaging	Het
Fbxw7	T	C	3: 84,952,380 (GRCm38)		probably benign	Het
Gba1	C	T	3: 89,204,081 (GRCm38)	P51L	probably benign	Het
Idh3b	AG	AGCACCACAACTG	2: 130,279,673 (GRCm38)		probably null	Het
Madd	T	C	2: 91,167,059 (GRCm38)	T755A	probably benign	Het
Mrps31	A	G	8: 22,414,865 (GRCm38)	D90G	probably benign	Het
Or14j4	T	A	17: 37,609,996 (GRCm38)	T252S	possibly damaging	Het
Or5h23	A	T	16: 59,086,043 (GRCm38)	L147M	probably benign	Het
P2ry12	T	A	3: 59,217,511 (GRCm38)	I248F	probably benign	Het
Ptgfrn	T	C	3: 101,045,639 (GRCm38)	R760G	probably damaging	Het
Rsf1	CG	CGACGGCGGGG	7: 97,579,908 (GRCm38)		probably benign	Homo
Slpi	T	C	2: 164,354,926 (GRCm38)	Y116C	probably damaging	Het
St3gal1	A	G	15: 67,111,346 (GRCm38)	V187A	possibly damaging	Het
Terb1	T	A	8: 104,473,037 (GRCm38)	E425V	probably damaging	Het
Thbs2	A	G	17: 14,685,796 (GRCm38)	S281P	probably benign	Het
Tnik	A	G	3: 28,263,643 (GRCm38)	M1V	probably null	Het
Usp16	G	A	16: 87,483,135 (GRCm38)	S741N	probably benign	Het
Usp48	T	C	4: 137,609,108 (GRCm38)		probably null	Het
Vipr1	T	C	9: 121,668,555 (GRCm38)	S380P	probably damaging	Het
Vmn1r21	A	T	6: 57,843,598 (GRCm38)	I287K	probably damaging	Het
Zfp157	T	C	5: 138,455,926 (GRCm38)	C129R	probably damaging	Het

Other mutations in Kalrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01361:Kalrn	APN	16	34,175,722 (GRCm38)	splice site	probably benign
IGL01364:Kalrn	APN	16	34,262,629 (GRCm38)	missense	probably damaging	1.00
IGL01510:Kalrn	APN	16	34,235,330 (GRCm38)	missense	possibly damaging	0.52
IGL01664:Kalrn	APN	16	34,294,161 (GRCm38)	missense	probably damaging	1.00
IGL01934:Kalrn	APN	16	34,198,512 (GRCm38)	splice site	probably null
IGL02059:Kalrn	APN	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
IGL02102:Kalrn	APN	16	34,220,222 (GRCm38)	missense	probably damaging	1.00
IGL02306:Kalrn	APN	16	34,310,527 (GRCm38)	missense	probably damaging	0.97
IGL02328:Kalrn	APN	16	34,332,224 (GRCm38)	missense	probably damaging	0.98
IGL02532:Kalrn	APN	16	34,360,846 (GRCm38)	missense	probably damaging	1.00
IGL02685:Kalrn	APN	16	34,513,959 (GRCm38)	nonsense	probably null
IGL02696:Kalrn	APN	16	34,220,114 (GRCm38)	missense	probably damaging	1.00
IGL02708:Kalrn	APN	16	34,392,050 (GRCm38)	missense	probably damaging	1.00
IGL02937:Kalrn	APN	16	34,220,130 (GRCm38)	nonsense	probably null
IGL03188:Kalrn	APN	16	34,314,192 (GRCm38)	missense	probably benign	0.01
IGL03289:Kalrn	APN	16	34,385,297 (GRCm38)	missense	possibly damaging	0.90
IGL03408:Kalrn	APN	16	34,314,176 (GRCm38)	missense	probably damaging	0.99
breeze	UTSW	16	34,013,675 (GRCm38)	missense
ethereal	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
Feather	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
Hidden	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
Soulful	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
G1Funyon:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
PIT4498001:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	possibly damaging	0.81
R0019:Kalrn	UTSW	16	34,198,514 (GRCm38)	splice site	probably benign
R0043:Kalrn	UTSW	16	34,054,906 (GRCm38)	missense	probably damaging	1.00
R0052:Kalrn	UTSW	16	34,357,171 (GRCm38)	missense	probably damaging	1.00
R0066:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0098:Kalrn	UTSW	16	33,975,619 (GRCm38)	missense	possibly damaging	0.89
R0111:Kalrn	UTSW	16	34,031,590 (GRCm38)	missense	probably damaging	1.00
R0113:Kalrn	UTSW	16	34,049,936 (GRCm38)	intron	probably benign
R0183:Kalrn	UTSW	16	34,171,379 (GRCm38)	splice site	probably null
R0422:Kalrn	UTSW	16	34,314,273 (GRCm38)	missense	probably damaging	0.99
R0498:Kalrn	UTSW	16	34,054,891 (GRCm38)	missense	possibly damaging	0.61
R0614:Kalrn	UTSW	16	33,993,670 (GRCm38)	splice site	probably benign
R0656:Kalrn	UTSW	16	34,032,467 (GRCm38)	missense	probably damaging	1.00
R0671:Kalrn	UTSW	16	34,116,408 (GRCm38)	missense	probably benign	0.04
R0707:Kalrn	UTSW	16	34,010,581 (GRCm38)	missense	possibly damaging	0.88
R0709:Kalrn	UTSW	16	34,035,554 (GRCm38)	missense	probably damaging	1.00
R0834:Kalrn	UTSW	16	34,049,919 (GRCm38)	missense	possibly damaging	0.94
R0976:Kalrn	UTSW	16	34,385,390 (GRCm38)	missense	probably damaging	1.00
R1297:Kalrn	UTSW	16	34,016,498 (GRCm38)	missense	probably damaging	0.99
R1355:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1370:Kalrn	UTSW	16	33,975,584 (GRCm38)	missense	possibly damaging	0.74
R1389:Kalrn	UTSW	16	33,988,803 (GRCm38)	missense	probably benign	0.01
R1398:Kalrn	UTSW	16	34,212,820 (GRCm38)	missense	probably damaging	1.00
R1427:Kalrn	UTSW	16	33,975,754 (GRCm38)	missense	probably damaging	1.00
R1458:Kalrn	UTSW	16	34,174,487 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1470:Kalrn	UTSW	16	34,187,471 (GRCm38)	missense	probably damaging	1.00
R1557:Kalrn	UTSW	16	34,314,278 (GRCm38)	missense	possibly damaging	0.92
R1559:Kalrn	UTSW	16	34,010,548 (GRCm38)	missense	possibly damaging	0.92
R1654:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1703:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R1759:Kalrn	UTSW	16	34,360,950 (GRCm38)	missense	probably damaging	0.97
R1764:Kalrn	UTSW	16	34,212,873 (GRCm38)	missense	probably damaging	1.00
R1824:Kalrn	UTSW	16	34,294,215 (GRCm38)	missense	probably damaging	1.00
R1845:Kalrn	UTSW	16	34,356,961 (GRCm38)	missense	probably damaging	0.99
R1850:Kalrn	UTSW	16	33,975,923 (GRCm38)	missense	probably damaging	0.98
R1921:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1922:Kalrn	UTSW	16	34,392,093 (GRCm38)	missense	probably benign	0.02
R1970:Kalrn	UTSW	16	33,977,524 (GRCm38)	critical splice donor site	probably null
R1991:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R1992:Kalrn	UTSW	16	33,975,738 (GRCm38)	missense	probably damaging	1.00
R2001:Kalrn	UTSW	16	34,028,045 (GRCm38)	missense	probably damaging	1.00
R2025:Kalrn	UTSW	16	34,189,736 (GRCm38)	missense	probably damaging	0.96
R2048:Kalrn	UTSW	16	34,252,310 (GRCm38)	missense	probably benign	0.18
R2076:Kalrn	UTSW	16	34,332,143 (GRCm38)	missense	probably benign	0.15
R2118:Kalrn	UTSW	16	34,332,230 (GRCm38)	missense	possibly damaging	0.84
R2136:Kalrn	UTSW	16	34,307,724 (GRCm38)	missense	possibly damaging	0.82
R2145:Kalrn	UTSW	16	34,009,262 (GRCm38)	unclassified	probably benign
R2193:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2195:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2234:Kalrn	UTSW	16	34,176,262 (GRCm38)	splice site	probably null
R2404:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2405:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2408:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2411:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2570:Kalrn	UTSW	16	34,310,495 (GRCm38)	missense	probably damaging	1.00
R2903:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2904:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R2924:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R3411:Kalrn	UTSW	16	34,212,272 (GRCm38)	missense	probably benign	0.07
R3693:Kalrn	UTSW	16	34,357,315 (GRCm38)	missense	probably damaging	1.00
R3709:Kalrn	UTSW	16	34,392,030 (GRCm38)	splice site	probably null
R3788:Kalrn	UTSW	16	34,220,240 (GRCm38)	missense	probably damaging	1.00
R3833:Kalrn	UTSW	16	34,039,889 (GRCm38)	nonsense	probably null
R3871:Kalrn	UTSW	16	34,203,856 (GRCm38)	splice site	probably null
R3934:Kalrn	UTSW	16	34,310,531 (GRCm38)	missense	probably benign	0.34
R4033:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4056:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4057:Kalrn	UTSW	16	34,314,209 (GRCm38)	missense	probably damaging	0.99
R4303:Kalrn	UTSW	16	34,235,391 (GRCm38)	missense	probably damaging	1.00
R4402:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4444:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4482:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4487:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4558:Kalrn	UTSW	16	33,987,208 (GRCm38)	missense	possibly damaging	0.46
R4572:Kalrn	UTSW	16	34,392,042 (GRCm38)	missense	probably damaging	0.98
R4583:Kalrn	UTSW	16	34,235,267 (GRCm38)	missense	probably damaging	1.00
R4604:Kalrn	UTSW	16	34,513,926 (GRCm38)	missense	possibly damaging	0.46
R4620:Kalrn	UTSW	16	34,028,705 (GRCm38)	missense	probably damaging	0.99
R4651:Kalrn	UTSW	16	34,176,391 (GRCm38)	missense	probably damaging	1.00
R4703:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4704:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4705:Kalrn	UTSW	16	34,203,957 (GRCm38)	missense	probably damaging	1.00
R4760:Kalrn	UTSW	16	34,198,487 (GRCm38)	missense	probably damaging	1.00
R4793:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4794:Kalrn	UTSW	16	33,989,810 (GRCm38)	missense	possibly damaging	0.72
R4811:Kalrn	UTSW	16	34,356,969 (GRCm38)	missense	probably damaging	1.00
R4816:Kalrn	UTSW	16	34,514,019 (GRCm38)	unclassified	probably benign
R4888:Kalrn	UTSW	16	34,171,330 (GRCm38)	missense	probably damaging	1.00
R4952:Kalrn	UTSW	16	34,357,415 (GRCm38)	splice site	probably null
R5030:Kalrn	UTSW	16	33,975,742 (GRCm38)	missense	probably benign	0.00
R5045:Kalrn	UTSW	16	34,314,352 (GRCm38)	nonsense	probably null
R5117:Kalrn	UTSW	16	34,033,601 (GRCm38)	critical splice acceptor site	probably null
R5289:Kalrn	UTSW	16	34,252,341 (GRCm38)	missense	possibly damaging	0.95
R5426:Kalrn	UTSW	16	34,262,653 (GRCm38)	missense	probably damaging	1.00
R5432:Kalrn	UTSW	16	34,053,622 (GRCm38)	missense	probably damaging	1.00
R5611:Kalrn	UTSW	16	34,175,780 (GRCm38)	missense	probably damaging	1.00
R5629:Kalrn	UTSW	16	34,039,934 (GRCm38)	missense	possibly damaging	0.77
R5635:Kalrn	UTSW	16	34,014,084 (GRCm38)	missense	probably damaging	1.00
R5713:Kalrn	UTSW	16	34,016,579 (GRCm38)	missense	probably benign
R5716:Kalrn	UTSW	16	33,987,176 (GRCm38)	missense	probably benign	0.01
R5772:Kalrn	UTSW	16	33,975,820 (GRCm38)	missense	probably damaging	1.00
R5797:Kalrn	UTSW	16	34,212,249 (GRCm38)	missense	probably damaging	0.98
R5835:Kalrn	UTSW	16	33,987,091 (GRCm38)	missense	probably benign	0.28
R5895:Kalrn	UTSW	16	33,975,435 (GRCm38)	utr 3 prime	probably benign
R5924:Kalrn	UTSW	16	34,243,833 (GRCm38)	missense	probably damaging	1.00
R5999:Kalrn	UTSW	16	34,357,343 (GRCm38)	missense	probably damaging	1.00
R6010:Kalrn	UTSW	16	34,010,580 (GRCm38)	missense	probably benign	0.06
R6052:Kalrn	UTSW	16	34,360,885 (GRCm38)	missense	probably damaging	1.00
R6122:Kalrn	UTSW	16	33,985,191 (GRCm38)	missense	possibly damaging	0.82
R6128:Kalrn	UTSW	16	34,212,885 (GRCm38)	missense	probably damaging	0.99
R6136:Kalrn	UTSW	16	34,357,111 (GRCm38)	missense	probably damaging	1.00
R6178:Kalrn	UTSW	16	34,053,639 (GRCm38)	missense	possibly damaging	0.88
R6229:Kalrn	UTSW	16	34,055,071 (GRCm38)	missense	probably damaging	1.00
R6376:Kalrn	UTSW	16	33,975,991 (GRCm38)	missense	probably benign
R6397:Kalrn	UTSW	16	33,992,985 (GRCm38)	missense	probably damaging	1.00
R6429:Kalrn	UTSW	16	34,332,164 (GRCm38)	missense	possibly damaging	0.85
R6481:Kalrn	UTSW	16	34,360,984 (GRCm38)	missense	probably damaging	1.00
R6597:Kalrn	UTSW	16	34,182,747 (GRCm38)	missense	probably damaging	1.00
R6736:Kalrn	UTSW	16	34,217,923 (GRCm38)	missense	probably damaging	1.00
R6808:Kalrn	UTSW	16	34,027,976 (GRCm38)	missense	probably damaging	1.00
R6897:Kalrn	UTSW	16	33,975,703 (GRCm38)	missense	probably damaging	0.99
R6955:Kalrn	UTSW	16	34,220,136 (GRCm38)	missense	probably damaging	1.00
R7060:Kalrn	UTSW	16	34,357,048 (GRCm38)	missense	probably damaging	0.99
R7064:Kalrn	UTSW	16	34,217,891 (GRCm38)	missense	probably damaging	1.00
R7132:Kalrn	UTSW	16	34,256,227 (GRCm38)	missense	unknown
R7154:Kalrn	UTSW	16	34,212,157 (GRCm38)	critical splice donor site	probably null
R7181:Kalrn	UTSW	16	34,163,077 (GRCm38)	missense	probably benign	0.00
R7234:Kalrn	UTSW	16	34,176,422 (GRCm38)	missense	possibly damaging	0.63
R7235:Kalrn	UTSW	16	34,175,761 (GRCm38)	missense	probably benign	0.18
R7504:Kalrn	UTSW	16	34,256,233 (GRCm38)	missense	unknown
R7563:Kalrn	UTSW	16	34,392,094 (GRCm38)	missense	probably damaging	0.97
R7612:Kalrn	UTSW	16	34,314,212 (GRCm38)	missense	possibly damaging	0.68
R7772:Kalrn	UTSW	16	34,031,582 (GRCm38)	missense	probably benign	0.04
R7796:Kalrn	UTSW	16	34,187,484 (GRCm38)	nonsense	probably null
R7867:Kalrn	UTSW	16	33,989,791 (GRCm38)	missense	possibly damaging	0.94
R7869:Kalrn	UTSW	16	33,988,847 (GRCm38)	missense	probably damaging	0.98
R7914:Kalrn	UTSW	16	34,028,752 (GRCm38)	missense	probably benign
R8080:Kalrn	UTSW	16	33,975,668 (GRCm38)	missense	possibly damaging	0.83
R8147:Kalrn	UTSW	16	34,055,044 (GRCm38)	missense	probably benign
R8239:Kalrn	UTSW	16	34,049,783 (GRCm38)	missense	noncoding transcript
R8281:Kalrn	UTSW	16	34,035,061 (GRCm38)	nonsense	probably null
R8294:Kalrn	UTSW	16	34,033,584 (GRCm38)	missense	probably benign	0.12
R8301:Kalrn	UTSW	16	34,357,100 (GRCm38)	missense	probably benign	0.05
R8686:Kalrn	UTSW	16	34,360,935 (GRCm38)	missense	probably damaging	1.00
R8693:Kalrn	UTSW	16	34,034,514 (GRCm38)	missense	probably damaging	1.00
R8798:Kalrn	UTSW	16	33,982,855 (GRCm38)	missense	possibly damaging	0.65
R8878:Kalrn	UTSW	16	34,205,326 (GRCm38)	missense	probably damaging	1.00
R8878:Kalrn	UTSW	16	34,198,460 (GRCm38)	missense	probably benign	0.05
R8880:Kalrn	UTSW	16	34,217,935 (GRCm38)	missense	probably damaging	1.00
R8883:Kalrn	UTSW	16	33,993,655 (GRCm38)	missense	probably damaging	1.00
R8887:Kalrn	UTSW	16	34,227,126 (GRCm38)	missense	probably benign	0.22
R9048:Kalrn	UTSW	16	34,034,484 (GRCm38)	missense	possibly damaging	0.84
R9111:Kalrn	UTSW	16	34,361,001 (GRCm38)	missense	probably damaging	0.96
R9317:Kalrn	UTSW	16	34,013,675 (GRCm38)	missense
R9424:Kalrn	UTSW	16	33,988,818 (GRCm38)	missense	probably benign	0.06
R9442:Kalrn	UTSW	16	34,095,879 (GRCm38)	start codon destroyed	probably null	0.56
R9445:Kalrn	UTSW	16	33,985,230 (GRCm38)	missense	probably benign	0.13
R9515:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9516:Kalrn	UTSW	16	34,034,494 (GRCm38)	missense	probably damaging	1.00
R9625:Kalrn	UTSW	16	34,028,827 (GRCm38)	critical splice acceptor site	probably null
R9645:Kalrn	UTSW	16	34,212,213 (GRCm38)	missense	probably benign	0.01
RF014:Kalrn	UTSW	16	34,039,933 (GRCm38)	missense	probably benign	0.01
Z1177:Kalrn	UTSW	16	34,035,506 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGGACGGCACCTCTTACG -3'
(R):5'- ATGGCCTTGTGAGAACTTCG -3'

Sequencing Primer
(F):5'- GACGGCACCTCTTACGTACGTAC -3'
(R):5'- GAGTTGTAGCCATATCACACCTGG -3'

Posted On

2018-06-06