Incidental Mutation 'R6535:Cpt1a'
ID520369
Institutional Source Beutler Lab
Gene Symbol Cpt1a
Ensembl Gene ENSMUSG00000024900
Gene Namecarnitine palmitoyltransferase 1a, liver
SynonymsL-CPT I, CPTI, Cpt1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6535 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3323301-3385732 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to A at 3365788 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025835]
Predicted Effect probably null
Transcript: ENSMUST00000025835
SMART Domains Protein: ENSMUSP00000025835
Gene: ENSMUSG00000024900

DomainStartEndE-ValueType
Pfam:CPT_N 1 47 2.3e-30 PFAM
transmembrane domain 49 71 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
Pfam:Carn_acyltransf 171 762 6e-186 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display decreased serum glucose and increased serum free fatty acid levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Macrod1 A G 19: 7,057,147 D86G probably damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Cpt1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Cpt1a APN 19 3366389 missense possibly damaging 0.85
allosouris UTSW 19 3378472 missense probably damaging 1.00
Tyrannosouris UTSW 19 3362156 missense probably damaging 1.00
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0029:Cpt1a UTSW 19 3381674 missense probably benign 0.04
R0305:Cpt1a UTSW 19 3378455 missense probably benign
R0963:Cpt1a UTSW 19 3381634 missense probably damaging 1.00
R1511:Cpt1a UTSW 19 3365788 splice site probably benign
R2102:Cpt1a UTSW 19 3371585 missense probably benign 0.25
R3034:Cpt1a UTSW 19 3378390 missense probably damaging 1.00
R3153:Cpt1a UTSW 19 3356430 missense probably damaging 0.99
R5195:Cpt1a UTSW 19 3383800 missense possibly damaging 0.88
R5391:Cpt1a UTSW 19 3349260 missense probably damaging 0.98
R5964:Cpt1a UTSW 19 3365760 missense possibly damaging 0.80
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6031:Cpt1a UTSW 19 3371556 splice site probably null
R6246:Cpt1a UTSW 19 3376550 missense probably damaging 0.99
R6339:Cpt1a UTSW 19 3362152 missense probably benign 0.27
R6427:Cpt1a UTSW 19 3362156 missense probably damaging 1.00
R6621:Cpt1a UTSW 19 3378472 missense probably damaging 1.00
R6892:Cpt1a UTSW 19 3371660 missense probably benign 0.00
R7142:Cpt1a UTSW 19 3375100 missense probably benign 0.00
R7385:Cpt1a UTSW 19 3380155 missense probably damaging 0.99
R7908:Cpt1a UTSW 19 3362202 missense probably benign 0.26
R8098:Cpt1a UTSW 19 3370849 missense probably benign
R8362:Cpt1a UTSW 19 3370744 nonsense probably null
R8444:Cpt1a UTSW 19 3381981 missense probably benign
X0019:Cpt1a UTSW 19 3366348 missense probably benign 0.01
Z1177:Cpt1a UTSW 19 3366370 missense probably damaging 1.00
Z1177:Cpt1a UTSW 19 3370727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTATACAGACCGCCGTG -3'
(R):5'- GAAGAAACCGTTCTCCTGAGG -3'

Sequencing Primer
(F):5'- GTATACAGACCGCCGTGTCACC -3'
(R):5'- TGGATTCCCGGGATTGAACAC -3'
Posted On2018-06-06