Incidental Mutation 'R6473:Chmp2b'
ID 520370
Institutional Source Beutler Lab
Gene Symbol Chmp2b
Ensembl Gene ENSMUSG00000004843
Gene Name charged multivesicular body protein 2B
Synonyms 1190006E07Rik, chromatin modifying protein 2B
MMRRC Submission 044606-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.937) question?
Stock # R6473 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 65336014-65359612 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65343758 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Serine at position 96 (G96S)
Ref Sequence ENSEMBL: ENSMUSP00000156381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004965] [ENSMUST00000231259]
AlphaFold Q8BJF9
Predicted Effect probably damaging
Transcript: ENSMUST00000004965
AA Change: G100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004965
Gene: ENSMUSG00000004843
AA Change: G100S

DomainStartEndE-ValueType
Pfam:Snf7 16 186 1e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231259
AA Change: G96S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 96.9%
  • 20x: 89.9%
Validation Efficiency 95% (36/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) that functions in the recycling or degradation of cell surface receptors. ESCRT-III functions in the concentration and invagination of ubiquitinated endosomal cargos into intralumenal vesicles. The protein encoded by this gene is found as a monomer in the cytosol or as an oligomer in ESCRT-III complexes on endosomal membranes. It is expressed in neurons of all major regions of the brain. Mutations in this gene result in one form of familial frontotemporal lobar degeneration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a hypomorphic gene trapped allele display reduced dendritic spine and excitatory synapse density in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 T C 16: 85,596,531 (GRCm39) D106G probably damaging Het
Adat3 A G 10: 80,442,801 (GRCm39) D213G probably damaging Het
Akt1 T C 12: 112,628,694 (GRCm39) D32G probably damaging Het
Ampd1 C T 3: 103,002,962 (GRCm39) R61* probably null Het
Ash2l T A 8: 26,325,008 (GRCm39) T184S probably damaging Het
B3galnt1 T C 3: 69,482,673 (GRCm39) N196S possibly damaging Het
Cyp2d26 T C 15: 82,675,968 (GRCm39) N248S probably benign Het
Cyp46a1 G T 12: 108,321,734 (GRCm39) R320L possibly damaging Het
Dact1 A G 12: 71,364,472 (GRCm39) T418A probably benign Het
Ddx3y T C Y: 1,265,971 (GRCm39) Y342C possibly damaging Homo
Dnm3 T A 1: 162,305,274 (GRCm39) Q40L probably damaging Het
Eif2s1 T C 12: 78,927,999 (GRCm39) I225T probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Eps8 A T 6: 137,456,096 (GRCm39) I795N probably damaging Het
Fan1 T A 7: 64,022,234 (GRCm39) N340Y probably damaging Het
Fbxw7 T C 3: 84,859,687 (GRCm39) probably benign Het
Gba1 C T 3: 89,111,388 (GRCm39) P51L probably benign Het
Idh3b AG AGCACCACAACTG 2: 130,121,593 (GRCm39) probably null Het
Kalrn A G 16: 34,025,672 (GRCm39) I551T probably damaging Het
Madd T C 2: 90,997,404 (GRCm39) T755A probably benign Het
Mrps31 A G 8: 22,904,881 (GRCm39) D90G probably benign Het
Or14j4 T A 17: 37,920,887 (GRCm39) T252S possibly damaging Het
Or5h23 A T 16: 58,906,406 (GRCm39) L147M probably benign Het
P2ry12 T A 3: 59,124,932 (GRCm39) I248F probably benign Het
Ptgfrn T C 3: 100,952,955 (GRCm39) R760G probably damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,229,115 (GRCm39) probably benign Homo
Slpi T C 2: 164,196,846 (GRCm39) Y116C probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Terb1 T A 8: 105,199,669 (GRCm39) E425V probably damaging Het
Thbs2 A G 17: 14,906,058 (GRCm39) S281P probably benign Het
Tnik A G 3: 28,317,792 (GRCm39) M1V probably null Het
Usp16 G A 16: 87,280,023 (GRCm39) S741N probably benign Het
Usp48 T C 4: 137,336,419 (GRCm39) probably null Het
Vipr1 T C 9: 121,497,621 (GRCm39) S380P probably damaging Het
Vmn1r21 A T 6: 57,820,583 (GRCm39) I287K probably damaging Het
Zfp157 T C 5: 138,454,188 (GRCm39) C129R probably damaging Het
Other mutations in Chmp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Chmp2b APN 16 65,359,363 (GRCm39) missense probably benign 0.01
IGL01807:Chmp2b APN 16 65,337,091 (GRCm39) missense probably benign
R0256:Chmp2b UTSW 16 65,337,078 (GRCm39) missense probably benign 0.18
R1688:Chmp2b UTSW 16 65,347,922 (GRCm39) missense probably benign 0.00
R1923:Chmp2b UTSW 16 65,342,213 (GRCm39) missense possibly damaging 0.56
R2155:Chmp2b UTSW 16 65,343,877 (GRCm39) missense probably benign 0.09
R4845:Chmp2b UTSW 16 65,347,862 (GRCm39) missense probably damaging 0.99
R5559:Chmp2b UTSW 16 65,337,316 (GRCm39) missense probably damaging 1.00
R6333:Chmp2b UTSW 16 65,337,136 (GRCm39) missense possibly damaging 0.75
R7142:Chmp2b UTSW 16 65,343,794 (GRCm39) nonsense probably null
R7339:Chmp2b UTSW 16 65,342,232 (GRCm39) nonsense probably null
R7761:Chmp2b UTSW 16 65,343,745 (GRCm39) missense possibly damaging 0.48
R8034:Chmp2b UTSW 16 65,343,769 (GRCm39) missense probably benign 0.33
R8780:Chmp2b UTSW 16 65,359,422 (GRCm39) unclassified probably benign
R9537:Chmp2b UTSW 16 65,347,932 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAATGTCCTTTTAACACCCCAATC -3'
(R):5'- GATACTCTCTGATGACTGCCCC -3'

Sequencing Primer
(F):5'- CACTAAGCTAGATGCACAATTACTTG -3'
(R):5'- GATGACTGCCCCTTGATTTTATTTC -3'
Posted On 2018-06-06