Incidental Mutation 'R6535:Macrod1'
ID520373
Institutional Source Beutler Lab
Gene Symbol Macrod1
Ensembl Gene ENSMUSG00000036278
Gene NameMACRO domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6535 (G1)
Quality Score174.009
Status Not validated
Chromosome19
Chromosomal Location7056768-7198061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7057147 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 86 (D86G)
Ref Sequence ENSEMBL: ENSMUSP00000039507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040261]
Predicted Effect probably damaging
Transcript: ENSMUST00000040261
AA Change: D86G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039507
Gene: ENSMUSG00000036278
AA Change: D86G

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 25 41 N/A INTRINSIC
low complexity region 59 74 N/A INTRINSIC
A1pp 151 281 7.67e-46 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 G A 17: 43,440,029 S495N probably benign Het
Ank3 G T 10: 69,877,854 A448S probably damaging Het
Apobec3 A G 15: 79,897,749 *47W probably null Het
B4gat1 T C 19: 5,039,530 V185A possibly damaging Het
Cers1 T A 8: 70,330,154 V58D probably damaging Het
Chrm1 T A 19: 8,679,073 Y381N possibly damaging Het
Cpne6 A T 14: 55,513,665 E177V probably benign Het
Cpt1a T A 19: 3,365,788 probably null Het
Ctsq A T 13: 61,035,326 I334N probably damaging Het
D730001G18Rik T C 15: 74,772,225 S81G probably damaging Het
Dennd6b A G 15: 89,186,367 L400P probably damaging Het
Fam135b A G 15: 71,622,075 S2P probably damaging Het
Gm20767 T C 13: 120,154,654 S10P probably damaging Het
Hip1 T C 5: 135,428,497 probably null Het
Lama2 A C 10: 27,104,131 L1896R probably damaging Het
Macf1 A T 4: 123,471,935 V3011D possibly damaging Het
Mettl8 G T 2: 70,973,389 H185N possibly damaging Het
Mipol1 A C 12: 57,306,100 Q75P possibly damaging Het
Pi4ka C T 16: 17,301,036 V125M probably damaging Het
Pole A C 5: 110,324,807 Y1618S probably damaging Het
Prrc2a A G 17: 35,162,265 V21A unknown Het
Rhbdl1 A T 17: 25,835,825 Y111* probably null Het
Sbk3 A C 7: 4,969,841 M110R possibly damaging Het
Scn8a G A 15: 100,959,707 probably benign Het
Tshz3 T C 7: 36,768,789 S68P probably damaging Het
Vmn1r88 C T 7: 13,178,185 T156I probably benign Het
Wrn T C 8: 33,336,103 H177R probably damaging Het
Other mutations in Macrod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03280:Macrod1 APN 19 7197572 missense possibly damaging 0.93
R0138:Macrod1 UTSW 19 7196916 unclassified probably benign
R2697:Macrod1 UTSW 19 7196792 missense probably damaging 1.00
R3085:Macrod1 UTSW 19 7196494 missense probably damaging 1.00
R7688:Macrod1 UTSW 19 7196865 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGTAAATAGAGTCCGAGTGGGC -3'
(R):5'- TTCCCCACTCGTTTAGTCAAGG -3'

Sequencing Primer
(F):5'- TGCTCATGTCGCTGCAGAG -3'
(R):5'- CCACTCGTTTAGTCAAGGGGTAAC -3'
Posted On2018-06-06