Incidental Mutation 'R6536:Pou3f3'
ID520378
Institutional Source Beutler Lab
Gene Symbol Pou3f3
Ensembl Gene ENSMUSG00000045515
Gene NamePOU domain, class 3, transcription factor 3
SynonymsOtf8, Brn1, Brn-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location42695768-42703176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42698214 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 357 (I357V)
Ref Sequence ENSEMBL: ENSMUSP00000052088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054883]
Predicted Effect probably damaging
Transcript: ENSMUST00000054883
AA Change: I357V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052088
Gene: ENSMUSG00000045515
AA Change: I357V

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
low complexity region 132 146 N/A INTRINSIC
low complexity region 162 206 N/A INTRINSIC
low complexity region 212 224 N/A INTRINSIC
low complexity region 235 250 N/A INTRINSIC
low complexity region 269 301 N/A INTRINSIC
POU 311 385 9.06e-54 SMART
HOX 403 465 3.91e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177136
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199521
Meta Mutation Damage Score 0.3957 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a POU-domain containing protein that functions as a transcription factor. The encoded protein recognizes an octamer sequence in the DNA of target genes. This protein may play a role in development of the nervous system. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in death within 36 hours after birth. Mutant brains exhibit disorganized cells in the hippocampus and adjacent transitional cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Pou3f3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02143:Pou3f3 APN 1 42698526 missense probably benign 0.05
R0800:Pou3f3 UTSW 1 42698367 missense probably damaging 1.00
R2314:Pou3f3 UTSW 1 42698491 missense probably damaging 1.00
R4391:Pou3f3 UTSW 1 42697458 missense unknown
R4529:Pou3f3 UTSW 1 42698554 missense probably benign 0.15
R5233:Pou3f3 UTSW 1 42698278 missense probably benign 0.17
R7750:Pou3f3 UTSW 1 42698148 missense probably damaging 1.00
R7936:Pou3f3 UTSW 1 42697400 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAGTCTGCTGTACTCGCAG -3'
(R):5'- TTGACGCTAACCTCGATGGAG -3'

Sequencing Primer
(F):5'- TGAACGGCATGCTGAGC -3'
(R):5'- TCGATGGAGGTCCGCTTC -3'
Posted On2018-06-06