Incidental Mutation 'R6536:Or4f14'
ID 520387
Institutional Source Beutler Lab
Gene Symbol Or4f14
Ensembl Gene ENSMUSG00000096566
Gene Name olfactory receptor family 4 subfamily F member 14
Synonyms Olfr1306, GA_x6K02T2Q125-72954873-72953935, MOR245-15
MMRRC Submission 044662-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R6536 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111742335-111743273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 111743119 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000151142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099607] [ENSMUST00000214844]
AlphaFold A2BFL7
Predicted Effect possibly damaging
Transcript: ENSMUST00000099607
AA Change: D52G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097202
Gene: ENSMUSG00000096566
AA Change: D52G

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 4.7e-43 PFAM
Pfam:7tm_1 41 287 9.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214844
AA Change: D52G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 48,910,550 (GRCm39) H628N probably benign Het
Abcb1a T A 5: 8,769,030 (GRCm39) F751I probably benign Het
Adamts13 G A 2: 26,865,762 (GRCm39) V106M probably damaging Het
Add1 C A 5: 34,758,780 (GRCm39) N31K possibly damaging Het
Adgrf5 G T 17: 43,733,552 (GRCm39) probably benign Het
Akap11 T G 14: 78,748,754 (GRCm39) D1211A possibly damaging Het
Atp5f1c G A 2: 10,085,127 (GRCm39) probably benign Het
Cd320 T C 17: 34,066,477 (GRCm39) S72P probably benign Het
Clca4b C A 3: 144,622,490 (GRCm39) W525L possibly damaging Het
Cripto A T 9: 110,773,257 (GRCm39) probably null Het
Csmd3 G A 15: 47,701,863 (GRCm39) T1740I probably damaging Het
Dnah7c T G 1: 46,697,450 (GRCm39) S2122A probably benign Het
Enpp2 T C 15: 54,726,027 (GRCm39) N583S probably damaging Het
Fcsk A G 8: 111,610,511 (GRCm39) V964A possibly damaging Het
Gpd2 A T 2: 57,235,367 (GRCm39) I366F probably benign Het
Hsd17b2 G A 8: 118,428,921 (GRCm39) V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 (GRCm39) probably null Het
Idh3b AG AGCACCACAACTG 2: 130,121,593 (GRCm39) probably null Het
Ifi44 A G 3: 151,438,126 (GRCm39) V387A probably benign Het
Kcnc4 T C 3: 107,355,512 (GRCm39) D312G possibly damaging Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Klra6 C T 6: 130,000,682 (GRCm39) V41I probably benign Het
Lrp1 A G 10: 127,393,937 (GRCm39) probably null Het
Mpdz T C 4: 81,301,654 (GRCm39) E257G probably damaging Het
Or10v1 T C 19: 11,873,760 (GRCm39) V125A probably benign Het
Papln A G 12: 83,828,661 (GRCm39) Y789C probably damaging Het
Pcdh15 T C 10: 74,467,221 (GRCm39) L1680P probably damaging Het
Pcdhac1 A G 18: 37,223,367 (GRCm39) N60S probably benign Het
Polr3g T C 13: 81,826,335 (GRCm39) N162S unknown Het
Pou3f3 A G 1: 42,737,374 (GRCm39) I357V probably damaging Het
Sycp2 A G 2: 177,993,441 (GRCm39) S1235P probably damaging Het
Tns3 A T 11: 8,384,531 (GRCm39) V1429E probably damaging Het
Trim67 T C 8: 125,521,081 (GRCm39) S148P possibly damaging Het
Usp49 A T 17: 47,990,617 (GRCm39) I348F probably damaging Het
Wac A T 18: 7,905,189 (GRCm39) probably null Het
Zfp775 A G 6: 48,596,543 (GRCm39) K139R probably damaging Het
Other mutations in Or4f14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Or4f14 APN 2 111,742,381 (GRCm39) missense possibly damaging 0.95
IGL01310:Or4f14 APN 2 111,742,652 (GRCm39) missense probably benign 0.34
IGL01893:Or4f14 APN 2 111,742,589 (GRCm39) missense possibly damaging 0.65
IGL02433:Or4f14 APN 2 111,742,762 (GRCm39) missense probably damaging 1.00
IGL03302:Or4f14 APN 2 111,743,167 (GRCm39) missense possibly damaging 0.61
R0544:Or4f14 UTSW 2 111,742,905 (GRCm39) nonsense probably null
R0674:Or4f14 UTSW 2 111,743,018 (GRCm39) missense probably benign 0.41
R1118:Or4f14 UTSW 2 111,743,222 (GRCm39) missense probably benign 0.02
R1764:Or4f14 UTSW 2 111,742,526 (GRCm39) missense possibly damaging 0.93
R2915:Or4f14 UTSW 2 111,743,064 (GRCm39) missense probably damaging 1.00
R3976:Or4f14 UTSW 2 111,742,951 (GRCm39) missense possibly damaging 0.84
R4855:Or4f14 UTSW 2 111,742,444 (GRCm39) missense probably benign 0.41
R6475:Or4f14 UTSW 2 111,743,204 (GRCm39) nonsense probably null
R6513:Or4f14 UTSW 2 111,743,228 (GRCm39) missense possibly damaging 0.89
R6748:Or4f14 UTSW 2 111,742,702 (GRCm39) missense possibly damaging 0.47
R6843:Or4f14 UTSW 2 111,743,260 (GRCm39) missense probably damaging 1.00
R7006:Or4f14 UTSW 2 111,742,601 (GRCm39) missense probably benign 0.16
R7169:Or4f14 UTSW 2 111,742,939 (GRCm39) missense possibly damaging 0.95
R7230:Or4f14 UTSW 2 111,742,906 (GRCm39) missense probably damaging 1.00
R7419:Or4f14 UTSW 2 111,742,435 (GRCm39) missense probably damaging 1.00
R7448:Or4f14 UTSW 2 111,742,637 (GRCm39) missense probably benign 0.00
R7753:Or4f14 UTSW 2 111,742,927 (GRCm39) missense probably benign 0.06
R7761:Or4f14 UTSW 2 111,743,222 (GRCm39) missense probably benign 0.02
R8330:Or4f14 UTSW 2 111,742,724 (GRCm39) missense probably benign 0.00
R8497:Or4f14 UTSW 2 111,742,964 (GRCm39) missense possibly damaging 0.82
R8942:Or4f14 UTSW 2 111,743,207 (GRCm39) missense probably benign 0.05
R9603:Or4f14 UTSW 2 111,743,128 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCTATGAGCAGCACCATCTC -3'
(R):5'- ATGTGAGGTGATTTCACTGCAG -3'

Sequencing Primer
(F):5'- TATGAGCAGCACCATCTCCACAC -3'
(R):5'- CACTGCAGTTTGAAGTTATGATCCTC -3'
Posted On 2018-06-06