Incidental Mutation 'R6536:Olfr1306'
ID520387
Institutional Source Beutler Lab
Gene Symbol Olfr1306
Ensembl Gene ENSMUSG00000096566
Gene Nameolfactory receptor 1306
SynonymsGA_x6K02T2Q125-72954873-72953935, MOR245-15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111911264-111916271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111912774 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000151142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099607] [ENSMUST00000214844]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099607
AA Change: D52G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097202
Gene: ENSMUSG00000096566
AA Change: D52G

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 4.7e-43 PFAM
Pfam:7tm_1 41 287 9.7e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214844
AA Change: D52G

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Olfr1306
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Olfr1306 APN 2 111912036 missense possibly damaging 0.95
IGL01310:Olfr1306 APN 2 111912307 missense probably benign 0.34
IGL01893:Olfr1306 APN 2 111912244 missense possibly damaging 0.65
IGL02433:Olfr1306 APN 2 111912417 missense probably damaging 1.00
IGL03302:Olfr1306 APN 2 111912822 missense possibly damaging 0.61
R0544:Olfr1306 UTSW 2 111912560 nonsense probably null
R0674:Olfr1306 UTSW 2 111912673 missense probably benign 0.41
R1118:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R1764:Olfr1306 UTSW 2 111912181 missense possibly damaging 0.93
R2915:Olfr1306 UTSW 2 111912719 missense probably damaging 1.00
R3976:Olfr1306 UTSW 2 111912606 missense possibly damaging 0.84
R4855:Olfr1306 UTSW 2 111912099 missense probably benign 0.41
R6475:Olfr1306 UTSW 2 111912859 nonsense probably null
R6513:Olfr1306 UTSW 2 111912883 missense possibly damaging 0.89
R6748:Olfr1306 UTSW 2 111912357 missense possibly damaging 0.47
R6843:Olfr1306 UTSW 2 111912915 missense probably damaging 1.00
R7006:Olfr1306 UTSW 2 111912256 missense probably benign 0.16
R7169:Olfr1306 UTSW 2 111912594 missense possibly damaging 0.95
R7230:Olfr1306 UTSW 2 111912561 missense probably damaging 1.00
R7419:Olfr1306 UTSW 2 111912090 missense probably damaging 1.00
R7448:Olfr1306 UTSW 2 111912292 missense probably benign 0.00
R7753:Olfr1306 UTSW 2 111912582 missense probably benign 0.06
R7761:Olfr1306 UTSW 2 111912877 missense probably benign 0.02
R8330:Olfr1306 UTSW 2 111912379 missense probably benign 0.00
R8497:Olfr1306 UTSW 2 111912619 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTATGAGCAGCACCATCTC -3'
(R):5'- ATGTGAGGTGATTTCACTGCAG -3'

Sequencing Primer
(F):5'- TATGAGCAGCACCATCTCCACAC -3'
(R):5'- CACTGCAGTTTGAAGTTATGATCCTC -3'
Posted On2018-06-06