Incidental Mutation 'R6536:Idh3b'
ID520389
Institutional Source Beutler Lab
Gene Symbol Idh3b
Ensembl Gene ENSMUSG00000027406
Gene Nameisocitrate dehydrogenase 3 (NAD+) beta
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6536 (G1)
Quality Score217.468
Status Validated
Chromosome2
Chromosomal Location130279309-130284547 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AG to AGCACCACAACTG at 130279673 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028890] [ENSMUST00000028892] [ENSMUST00000103198] [ENSMUST00000136621] [ENSMUST00000184538] [ENSMUST00000159373]
Predicted Effect probably benign
Transcript: ENSMUST00000028890
SMART Domains Protein: ENSMUSP00000028890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Nop 44 127 1.1e-26 PFAM
coiled coil region 131 176 N/A INTRINSIC
low complexity region 185 204 N/A INTRINSIC
low complexity region 213 228 N/A INTRINSIC
low complexity region 242 264 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028892
SMART Domains Protein: ENSMUSP00000028892
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
Iso_dh 49 375 1.43e-140 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083355
Predicted Effect probably benign
Transcript: ENSMUST00000103198
SMART Domains Protein: ENSMUSP00000099487
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 5 70 4.3e-20 PFAM
NOSIC 167 219 1.18e-30 SMART
internal_repeat_1 257 305 4.06e-5 PROSPERO
coiled coil region 415 460 N/A INTRINSIC
low complexity region 469 488 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 526 548 N/A INTRINSIC
low complexity region 564 576 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133351
Predicted Effect probably benign
Transcript: ENSMUST00000136621
SMART Domains Protein: ENSMUSP00000124616
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 4 70 3.6e-22 PFAM
NOSIC 167 219 1.18e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138163
Predicted Effect probably benign
Transcript: ENSMUST00000141872
SMART Domains Protein: ENSMUSP00000125305
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:NOP5NT 14 79 3.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000184538
SMART Domains Protein: ENSMUSP00000139331
Gene: ENSMUSG00000027406

DomainStartEndE-ValueType
Pfam:Iso_dh 6 71 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162063
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160976
Predicted Effect probably benign
Transcript: ENSMUST00000149955
SMART Domains Protein: ENSMUSP00000123879
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
NOSIC 2 35 1.24e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150745
Predicted Effect probably benign
Transcript: ENSMUST00000159373
SMART Domains Protein: ENSMUSP00000124080
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 10 94 6e-28 PFAM
coiled coil region 98 135 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175746
Predicted Effect probably benign
Transcript: ENSMUST00000143547
Predicted Effect probably benign
Transcript: ENSMUST00000146454
SMART Domains Protein: ENSMUSP00000125304
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 1 152 7.8e-66 PFAM
coiled coil region 159 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150401
SMART Domains Protein: ENSMUSP00000123890
Gene: ENSMUSG00000027405

DomainStartEndE-ValueType
Pfam:Nop 26 103 3.9e-26 PFAM
coiled coil region 110 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160183
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Idh3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Idh3b APN 2 130281897 missense possibly damaging 0.87
IGL02821:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03057:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03106:Idh3b APN 2 130284401 missense probably benign 0.00
IGL03159:Idh3b APN 2 130284401 missense probably benign 0.00
R0090:Idh3b UTSW 2 130280979 missense probably benign 0.01
R1191:Idh3b UTSW 2 130281890 missense probably benign 0.43
R1443:Idh3b UTSW 2 130284054 splice site probably null
R1634:Idh3b UTSW 2 130281745 missense probably benign 0.39
R1644:Idh3b UTSW 2 130281510 missense possibly damaging 0.95
R5784:Idh3b UTSW 2 130279671 missense probably damaging 1.00
R5847:Idh3b UTSW 2 130284028 missense probably benign 0.00
R6469:Idh3b UTSW 2 130279673 frame shift probably null
R6473:Idh3b UTSW 2 130279673 frame shift probably null
R6532:Idh3b UTSW 2 130279673 frame shift probably null
R6959:Idh3b UTSW 2 130281527 missense probably damaging 1.00
R7019:Idh3b UTSW 2 130280966 missense probably damaging 1.00
R7305:Idh3b UTSW 2 130281493 missense possibly damaging 0.89
R7505:Idh3b UTSW 2 130284227 missense probably benign
R7505:Idh3b UTSW 2 130284233 missense probably benign
R7608:Idh3b UTSW 2 130280980 missense probably damaging 1.00
R7887:Idh3b UTSW 2 130281758 missense probably damaging 1.00
R8165:Idh3b UTSW 2 130280500 missense possibly damaging 0.73
Z1176:Idh3b UTSW 2 130281542 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCATCTTAGGGTCTGGGCC -3'
(R):5'- TTACAGGCAGGGTTAGCTGC -3'

Sequencing Primer
(F):5'- TGGGCCTTGTCGCAACAAC -3'
(R):5'- GGTCTCATTTCTTGCAAGGTAAC -3'
Posted On2018-06-06