Incidental Mutation 'R6495:Dnajc6'
ID520398
Institutional Source Beutler Lab
Gene Symbol Dnajc6
Ensembl Gene ENSMUSG00000028528
Gene NameDnaJ heat shock protein family (Hsp40) member C6
Synonymsauxilin, 2810027M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location101496648-101642799 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 101635065 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 766 (Q766*)
Ref Sequence ENSEMBL: ENSMUSP00000102546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038207] [ENSMUST00000094953] [ENSMUST00000106929] [ENSMUST00000106930] [ENSMUST00000106933]
Predicted Effect probably null
Transcript: ENSMUST00000038207
AA Change: Q736*
SMART Domains Protein: ENSMUSP00000044251
Gene: ENSMUSG00000028528
AA Change: Q736*

DomainStartEndE-ValueType
SCOP:d1d5ra2 88 244 1e-20 SMART
PTEN_C2 251 390 5.95e-42 SMART
low complexity region 502 521 N/A INTRINSIC
low complexity region 554 569 N/A INTRINSIC
low complexity region 679 694 N/A INTRINSIC
low complexity region 719 735 N/A INTRINSIC
low complexity region 829 840 N/A INTRINSIC
DnaJ 873 934 2e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000094953
AA Change: Q698*
SMART Domains Protein: ENSMUSP00000092560
Gene: ENSMUSG00000028528
AA Change: Q698*

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106929
AA Change: Q698*
SMART Domains Protein: ENSMUSP00000102542
Gene: ENSMUSG00000028528
AA Change: Q698*

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106930
AA Change: Q698*
SMART Domains Protein: ENSMUSP00000102543
Gene: ENSMUSG00000028528
AA Change: Q698*

DomainStartEndE-ValueType
SCOP:d1d5ra2 50 206 2e-20 SMART
PTEN_C2 213 352 5.95e-42 SMART
low complexity region 464 483 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
low complexity region 641 656 N/A INTRINSIC
low complexity region 681 697 N/A INTRINSIC
low complexity region 791 802 N/A INTRINSIC
DnaJ 835 896 2e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106933
AA Change: Q766*
SMART Domains Protein: ENSMUSP00000102546
Gene: ENSMUSG00000028528
AA Change: Q766*

DomainStartEndE-ValueType
low complexity region 30 44 N/A INTRINSIC
SCOP:d1d5ra2 118 274 1e-20 SMART
PTEN_C2 281 420 5.95e-42 SMART
low complexity region 532 551 N/A INTRINSIC
low complexity region 584 599 N/A INTRINSIC
low complexity region 709 724 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
DnaJ 903 964 2e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJC6 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus, a glycine/phenylalanine (G/F)-rich region, and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous and heterozygous for a knock-out allele exhibit postnatal lethality and decreased body weight with homozygotes exhibiting decreased synpatic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Dnajc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Dnajc6 APN 4 101508089 intron probably benign
IGL02336:Dnajc6 APN 4 101614286 unclassified probably null
IGL02551:Dnajc6 APN 4 101639353 missense probably damaging 1.00
IGL02801:Dnajc6 APN 4 101597813 missense probably benign 0.33
IGL02887:Dnajc6 APN 4 101639300 missense probably damaging 1.00
IGL03107:Dnajc6 APN 4 101616860 missense probably damaging 1.00
IGL03271:Dnajc6 APN 4 101508077 intron probably benign
R0091:Dnajc6 UTSW 4 101616777 splice site probably benign
R0384:Dnajc6 UTSW 4 101598956 missense probably damaging 1.00
R0546:Dnajc6 UTSW 4 101635191 missense probably damaging 0.99
R0689:Dnajc6 UTSW 4 101611253 missense possibly damaging 0.91
R1239:Dnajc6 UTSW 4 101635116 missense probably damaging 0.98
R1421:Dnajc6 UTSW 4 101611316 missense probably damaging 0.97
R1424:Dnajc6 UTSW 4 101639347 missense possibly damaging 0.92
R1563:Dnajc6 UTSW 4 101599137 missense probably damaging 1.00
R1608:Dnajc6 UTSW 4 101599167 missense probably damaging 1.00
R1757:Dnajc6 UTSW 4 101597831 missense probably damaging 1.00
R1856:Dnajc6 UTSW 4 101598988 missense probably damaging 1.00
R2032:Dnajc6 UTSW 4 101614238 missense probably benign 0.39
R2518:Dnajc6 UTSW 4 101612930 missense probably damaging 0.99
R4028:Dnajc6 UTSW 4 101616857 missense probably damaging 1.00
R4088:Dnajc6 UTSW 4 101639396 missense probably damaging 1.00
R4601:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4602:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4610:Dnajc6 UTSW 4 101611264 missense probably damaging 1.00
R4755:Dnajc6 UTSW 4 101550799 missense probably damaging 1.00
R4878:Dnajc6 UTSW 4 101599034 intron probably benign
R4938:Dnajc6 UTSW 4 101636813 missense probably damaging 1.00
R5373:Dnajc6 UTSW 4 101615627 missense probably damaging 0.99
R5391:Dnajc6 UTSW 4 101628158 critical splice donor site probably null
R5435:Dnajc6 UTSW 4 101606610 missense probably damaging 0.99
R5760:Dnajc6 UTSW 4 101618642 missense probably benign 0.39
R6044:Dnajc6 UTSW 4 101616577 missense probably benign 0.22
R6086:Dnajc6 UTSW 4 101597807 missense probably benign 0.45
R6460:Dnajc6 UTSW 4 101615598 missense probably damaging 1.00
R6956:Dnajc6 UTSW 4 101614273 missense probably damaging 0.97
R7072:Dnajc6 UTSW 4 101615615 missense probably damaging 1.00
R7155:Dnajc6 UTSW 4 101612945 missense probably damaging 1.00
R7192:Dnajc6 UTSW 4 101597803 missense probably benign 0.02
R7226:Dnajc6 UTSW 4 101639372 missense probably damaging 1.00
R7298:Dnajc6 UTSW 4 101606611 missense probably benign 0.09
R7612:Dnajc6 UTSW 4 101597926 missense probably benign 0.40
R7622:Dnajc6 UTSW 4 101640491 missense probably damaging 1.00
R7652:Dnajc6 UTSW 4 101606677 missense probably damaging 0.98
R7789:Dnajc6 UTSW 4 101618532 missense possibly damaging 0.82
R8010:Dnajc6 UTSW 4 101618414 missense not run
Z1088:Dnajc6 UTSW 4 101639329 missense probably damaging 1.00
Z1177:Dnajc6 UTSW 4 101639428 missense not run
Predicted Primers PCR Primer
(F):5'- TGTTACCACCCAAAGCAGTTTC -3'
(R):5'- CACCCTGTACCAGTCTCATG -3'

Sequencing Primer
(F):5'- GCAGTTTCCACTAAAATCATCACAAG -3'
(R):5'- GTCATCATCCTTACCCAAGTTAGTAG -3'
Posted On2018-06-06