Incidental Mutation 'R6536:Hsdl2'
ID520399
Institutional Source Beutler Lab
Gene Symbol Hsdl2
Ensembl Gene ENSMUSG00000028383
Gene Namehydroxysteroid dehydrogenase like 2
Synonyms2610207I16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6536 (G1)
Quality Score172.009
Status Validated
Chromosome4
Chromosomal Location59581563-59618689 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 59610508 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030078] [ENSMUST00000030078] [ENSMUST00000107528] [ENSMUST00000107528]
Predicted Effect probably null
Transcript: ENSMUST00000030078
SMART Domains Protein: ENSMUSP00000030078
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
Pfam:KR 11 142 6.3e-7 PFAM
Pfam:adh_short 11 209 2.9e-37 PFAM
Pfam:adh_short_C2 17 217 3.3e-11 PFAM
low complexity region 295 367 N/A INTRINSIC
Pfam:SCP2 382 484 4.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000030078
SMART Domains Protein: ENSMUSP00000030078
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
Pfam:KR 11 142 6.3e-7 PFAM
Pfam:adh_short 11 209 2.9e-37 PFAM
Pfam:adh_short_C2 17 217 3.3e-11 PFAM
low complexity region 295 367 N/A INTRINSIC
Pfam:SCP2 382 484 4.1e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107528
SMART Domains Protein: ENSMUSP00000103152
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
PDB:3KVO|B 1 174 1e-98 PDB
low complexity region 175 247 N/A INTRINSIC
Pfam:SCP2 262 364 2.5e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000107528
SMART Domains Protein: ENSMUSP00000103152
Gene: ENSMUSG00000028383

DomainStartEndE-ValueType
PDB:3KVO|B 1 174 1e-98 PDB
low complexity region 175 247 N/A INTRINSIC
Pfam:SCP2 262 364 2.5e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Hsdl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Hsdl2 APN 4 59596892 missense probably benign 0.26
IGL00857:Hsdl2 APN 4 59617735 missense probably benign 0.29
IGL01859:Hsdl2 APN 4 59601569 critical splice donor site probably null
IGL02822:Hsdl2 APN 4 59601379 missense possibly damaging 0.55
IGL03028:Hsdl2 APN 4 59594471 missense probably damaging 0.98
IGL03275:Hsdl2 APN 4 59617747 makesense probably null
R0217:Hsdl2 UTSW 4 59597311 missense probably damaging 1.00
R0294:Hsdl2 UTSW 4 59601408 missense probably benign 0.00
R0448:Hsdl2 UTSW 4 59606523 missense unknown
R0490:Hsdl2 UTSW 4 59612814 splice site probably benign
R1353:Hsdl2 UTSW 4 59596971 splice site probably null
R1668:Hsdl2 UTSW 4 59612697 missense probably damaging 1.00
R3933:Hsdl2 UTSW 4 59597274 missense probably damaging 1.00
R4088:Hsdl2 UTSW 4 59610636 missense unknown
R4247:Hsdl2 UTSW 4 59594417 missense probably damaging 1.00
R4449:Hsdl2 UTSW 4 59617692 missense possibly damaging 0.61
R4723:Hsdl2 UTSW 4 59593270 unclassified probably benign
R4858:Hsdl2 UTSW 4 59612812 critical splice donor site probably null
R5361:Hsdl2 UTSW 4 59592301 unclassified probably benign
R6435:Hsdl2 UTSW 4 59610668 missense unknown
R6525:Hsdl2 UTSW 4 59612696 missense probably damaging 0.99
R7156:Hsdl2 UTSW 4 59617653 missense possibly damaging 0.78
R7740:Hsdl2 UTSW 4 59612724 missense probably damaging 0.99
R8087:Hsdl2 UTSW 4 59592228 missense unknown
R8434:Hsdl2 UTSW 4 59610621 missense unknown
RF005:Hsdl2 UTSW 4 59610652 small insertion probably benign
RF013:Hsdl2 UTSW 4 59610657 small insertion probably benign
RF015:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF016:Hsdl2 UTSW 4 59610643 small insertion probably benign
RF020:Hsdl2 UTSW 4 59610640 small insertion probably benign
RF023:Hsdl2 UTSW 4 59610644 small insertion probably benign
RF025:Hsdl2 UTSW 4 59610637 small insertion probably benign
RF026:Hsdl2 UTSW 4 59610655 small insertion probably benign
RF028:Hsdl2 UTSW 4 59610650 nonsense probably null
RF030:Hsdl2 UTSW 4 59610647 small insertion probably benign
RF038:Hsdl2 UTSW 4 59610648 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610633 small insertion probably benign
RF049:Hsdl2 UTSW 4 59610651 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610636 small insertion probably benign
RF051:Hsdl2 UTSW 4 59610650 small insertion probably benign
RF056:Hsdl2 UTSW 4 59610647 frame shift probably null
RF059:Hsdl2 UTSW 4 59610658 small insertion probably benign
RF060:Hsdl2 UTSW 4 59610608 small insertion probably benign
RF061:Hsdl2 UTSW 4 59610657 small insertion probably benign
Z1176:Hsdl2 UTSW 4 59617706 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCCAACCTTTAACTTAGGAGAGATAG -3'
(R):5'- CTTCCACAGCTCCAAAATGTG -3'

Sequencing Primer
(F):5'- AGCTTTTTAGCATTCACAGCCACAG -3'
(R):5'- CATTGACTGCACAAATGGCTG -3'
Posted On2018-06-06