Incidental Mutation 'R6495:Exosc10'
ID520404
Institutional Source Beutler Lab
Gene Symbol Exosc10
Ensembl Gene ENSMUSG00000017264
Gene Nameexosome component 10
SynonymsPmscl2, PM-Scl, p3, p2, PM/Scl-100, RRP6, p4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148558429-148582401 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 148562872 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 213 (P213S)
Ref Sequence ENSEMBL: ENSMUSP00000017408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017408] [ENSMUST00000076022] [ENSMUST00000097781]
Predicted Effect probably benign
Transcript: ENSMUST00000017408
AA Change: P213S

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000017408
Gene: ENSMUSG00000017264
AA Change: P213S

DomainStartEndE-ValueType
Pfam:PMC2NT 44 133 2.7e-26 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 745 760 N/A INTRINSIC
coiled coil region 769 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000076022
AA Change: P213S

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000075401
Gene: ENSMUSG00000017264
AA Change: P213S

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 5.1e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
low complexity region 720 735 N/A INTRINSIC
coiled coil region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097781
AA Change: P213S

PolyPhen 2 Score 0.263 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095388
Gene: ENSMUSG00000017264
AA Change: P213S

DomainStartEndE-ValueType
Pfam:PMC2NT 43 134 1.4e-30 PFAM
low complexity region 219 230 N/A INTRINSIC
35EXOc 288 456 7.84e-53 SMART
HRDC 503 583 8.24e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173767
Meta Mutation Damage Score 0.0826 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Exosc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Exosc10 APN 4 148565271 missense probably damaging 1.00
IGL01591:Exosc10 APN 4 148562887 unclassified probably benign
IGL01990:Exosc10 APN 4 148566410 missense possibly damaging 0.83
IGL02137:Exosc10 APN 4 148561133 missense probably damaging 0.97
IGL02186:Exosc10 APN 4 148565298 missense probably damaging 0.96
IGL02412:Exosc10 APN 4 148568392 missense probably benign 0.15
IGL02880:Exosc10 APN 4 148576183 missense probably damaging 1.00
R0172:Exosc10 UTSW 4 148565357 missense probably benign 0.02
R0267:Exosc10 UTSW 4 148562756 missense probably damaging 1.00
R0592:Exosc10 UTSW 4 148581113 missense probably benign
R1122:Exosc10 UTSW 4 148566364 missense possibly damaging 0.86
R1218:Exosc10 UTSW 4 148570401 missense probably damaging 1.00
R1498:Exosc10 UTSW 4 148581786 missense possibly damaging 0.66
R1591:Exosc10 UTSW 4 148568383 missense probably benign 0.04
R1719:Exosc10 UTSW 4 148568503 missense probably damaging 1.00
R1760:Exosc10 UTSW 4 148578469 nonsense probably null
R3727:Exosc10 UTSW 4 148565277 missense probably damaging 1.00
R3842:Exosc10 UTSW 4 148563865 nonsense probably null
R3876:Exosc10 UTSW 4 148572919 missense probably benign 0.00
R4476:Exosc10 UTSW 4 148565324 missense probably damaging 0.98
R4750:Exosc10 UTSW 4 148562394 missense possibly damaging 0.69
R5306:Exosc10 UTSW 4 148562392 missense probably benign 0.13
R5438:Exosc10 UTSW 4 148566342 nonsense probably null
R5835:Exosc10 UTSW 4 148565387 missense probably damaging 1.00
R5925:Exosc10 UTSW 4 148573362 missense probably benign 0.01
R6116:Exosc10 UTSW 4 148573353 missense probably benign 0.08
R6217:Exosc10 UTSW 4 148582311 synonymous probably null
R6365:Exosc10 UTSW 4 148561105 missense probably benign 0.13
R6498:Exosc10 UTSW 4 148573338 missense probably benign
R6772:Exosc10 UTSW 4 148581134 missense probably damaging 1.00
R7297:Exosc10 UTSW 4 148580377 missense probably damaging 1.00
R7523:Exosc10 UTSW 4 148563842 critical splice acceptor site probably null
R7698:Exosc10 UTSW 4 148558498 missense probably benign
Z1177:Exosc10 UTSW 4 148565386 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTGTGTTGACTGCAGGC -3'
(R):5'- ATGAAATCTGCCAGGGCTG -3'

Sequencing Primer
(F):5'- CTGCAGGCAGGAGAGTATGGC -3'
(R):5'- ACATCCAGGTCCTCCGG -3'
Posted On2018-06-06