Incidental Mutation 'R6536:Abcb1a'
ID520405
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1A
SynonymsPgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location8660077-8748575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8719030 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 751 (F751I)
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
PDB Structure Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably benign
Transcript: ENSMUST00000047753
AA Change: F751I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584
AA Change: F751I

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145232
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8686257 missense probably benign 0.01
IGL00898:Abcb1a APN 5 8733690 missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8732388 missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8674687 missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8702550 missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8698637 missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8715065 critical splice donor site probably null
IGL01820:Abcb1a APN 5 8715896 splice site probably benign
IGL02499:Abcb1a APN 5 8726807 missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8723245 splice site probably null
IGL02954:Abcb1a APN 5 8732341 missense probably benign 0.00
IGL03018:Abcb1a APN 5 8702451 missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8714887 missense probably benign 0.00
IGL03292:Abcb1a APN 5 8715827 missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8694153 missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8713281 missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8698535 missense probably benign 0.01
R0595:Abcb1a UTSW 5 8740417 missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8698539 missense probably benign 0.13
R0811:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8674856 splice site probably benign
R0948:Abcb1a UTSW 5 8740621 splice site probably null
R1292:Abcb1a UTSW 5 8713343 missense probably benign 0.00
R1318:Abcb1a UTSW 5 8701621 missense probably benign 0.31
R1459:Abcb1a UTSW 5 8702920 missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8686300 critical splice donor site probably null
R1514:Abcb1a UTSW 5 8674791 missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8713202 missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8738747 missense probably benign 0.30
R2844:Abcb1a UTSW 5 8686164 missense probably benign 0.02
R3709:Abcb1a UTSW 5 8738738 missense probably benign 0.03
R3755:Abcb1a UTSW 5 8747403 missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8715068 splice site probably null
R4401:Abcb1a UTSW 5 8702390 missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8719981 splice site probably benign
R4539:Abcb1a UTSW 5 8715793 missense probably benign
R4635:Abcb1a UTSW 5 8714927 missense probably benign
R4740:Abcb1a UTSW 5 8702280 critical splice donor site probably null
R4757:Abcb1a UTSW 5 8737632 missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8715732 splice site probably null
R4792:Abcb1a UTSW 5 8746657 critical splice donor site probably null
R4829:Abcb1a UTSW 5 8723214 missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8737773 critical splice donor site probably null
R5140:Abcb1a UTSW 5 8702154 missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8714937 missense probably benign
R5355:Abcb1a UTSW 5 8726873 missense probably damaging 1.00
R5406:Abcb1a UTSW 5 8702946 missense probably damaging 0.99
R5496:Abcb1a UTSW 5 8674818 missense probably benign
R5557:Abcb1a UTSW 5 8714949 missense probably benign 0.01
R5572:Abcb1a UTSW 5 8715108 splice site probably null
R5702:Abcb1a UTSW 5 8737752 missense probably benign 0.15
R5753:Abcb1a UTSW 5 8723160 missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8683426 missense probably benign 0.01
R5895:Abcb1a UTSW 5 8702216 missense probably damaging 1.00
R6555:Abcb1a UTSW 5 8702468 missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8732364 missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8701628 missense probably benign 0.28
R7000:Abcb1a UTSW 5 8702823 missense probably benign 0.19
R7102:Abcb1a UTSW 5 8694072 missense probably benign 0.01
R7172:Abcb1a UTSW 5 8702399 missense probably benign 0.00
R7313:Abcb1a UTSW 5 8723187 missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8715771 nonsense probably null
R7718:Abcb1a UTSW 5 8715788 missense probably damaging 1.00
R7816:Abcb1a UTSW 5 8686132 missense possibly damaging 0.56
R7829:Abcb1a UTSW 5 8698623 missense probably benign 0.06
R7943:Abcb1a UTSW 5 8686222 missense probably benign
R8040:Abcb1a UTSW 5 8715035 missense probably benign 0.00
R8086:Abcb1a UTSW 5 8674833 missense probably benign
R8271:Abcb1a UTSW 5 8686212 missense probably benign 0.41
R8367:Abcb1a UTSW 5 8686221 missense probably benign 0.00
R8520:Abcb1a UTSW 5 8685346 missense possibly damaging 0.67
R8680:Abcb1a UTSW 5 8685371 missense probably damaging 0.99
R8820:Abcb1a UTSW 5 8723204 missense possibly damaging 0.69
Z1177:Abcb1a UTSW 5 8746544 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTTTATTCCAGAAACCGACTCT -3'
(R):5'- ACATGGTTGGTTGGGACAGA -3'

Sequencing Primer
(F):5'- CGACTCTATTCTAGCATAGAAAGGC -3'
(R):5'- TTGGTTGGGACAGAGAGGATG -3'
Posted On2018-06-06