Incidental Mutation 'R6536:Add1'
ID 520407
Institutional Source Beutler Lab
Gene Symbol Add1
Ensembl Gene ENSMUSG00000029106
Gene Name adducin 1
Synonyms
MMRRC Submission 044662-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.904) question?
Stock # R6536 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 34731008-34789652 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 34758780 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 31 (N31K)
Ref Sequence ENSEMBL: ENSMUSP00000109974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001108] [ENSMUST00000052836] [ENSMUST00000114335] [ENSMUST00000114338] [ENSMUST00000114340] [ENSMUST00000146295] [ENSMUST00000147574]
AlphaFold Q9QYC0
Predicted Effect possibly damaging
Transcript: ENSMUST00000001108
AA Change: N31K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000001108
Gene: ENSMUSG00000029106
AA Change: N31K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000052836
AA Change: N31K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000052266
Gene: ENSMUSG00000029106
AA Change: N31K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 599 631 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114335
AA Change: N31K

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109974
Gene: ENSMUSG00000029106
AA Change: N31K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 597 629 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114338
AA Change: N31K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109977
Gene: ENSMUSG00000029106
AA Change: N31K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114340
AA Change: N31K

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109979
Gene: ENSMUSG00000029106
AA Change: N31K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Aldolase_II 147 329 5.49e-58 SMART
coiled coil region 568 600 N/A INTRINSIC
low complexity region 666 685 N/A INTRINSIC
low complexity region 698 719 N/A INTRINSIC
low complexity region 727 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145986
Predicted Effect possibly damaging
Transcript: ENSMUST00000146295
AA Change: N31K

PolyPhen 2 Score 0.760 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000118539
Gene: ENSMUSG00000029106
AA Change: N31K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000147574
AA Change: N31K

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116075
Gene: ENSMUSG00000029106
AA Change: N31K

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Blast:Aldolase_II 102 140 1e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201368
Meta Mutation Damage Score 0.0741 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are a family of cytoskeleton proteins encoded by three genes (alpha, beta, gamma). Adducin is a heterodimeric protein that consists of related subunits, which are produced from distinct genes but share a similar structure. Alpha- and beta-adducin include a protease-resistant N-terminal region and a protease-sensitive, hydrophilic C-terminal region. Alpha- and gamma-adducins are ubiquitously expressed. In contrast, beta-adducin is expressed at high levels in brain and hematopoietic tissues. Adducin binds with high affinity to Ca(2+)/calmodulin and is a substrate for protein kinases A and C. Alternative splicing results in multiple variants encoding distinct isoforms; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted gene deletion leads to reduced growth and compensated hemolytic anemia. RBCs are osmotically fragile, dehydrated, and spherocytic with severe loss of membrane surface area and reduced MCV. ~50% of homozygotes develop lethal hydrocephaly with dilation of the lateral, 3rd, and 4th ventricles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 48,910,550 (GRCm39) H628N probably benign Het
Abcb1a T A 5: 8,769,030 (GRCm39) F751I probably benign Het
Adamts13 G A 2: 26,865,762 (GRCm39) V106M probably damaging Het
Adgrf5 G T 17: 43,733,552 (GRCm39) probably benign Het
Akap11 T G 14: 78,748,754 (GRCm39) D1211A possibly damaging Het
Atp5f1c G A 2: 10,085,127 (GRCm39) probably benign Het
Cd320 T C 17: 34,066,477 (GRCm39) S72P probably benign Het
Clca4b C A 3: 144,622,490 (GRCm39) W525L possibly damaging Het
Cripto A T 9: 110,773,257 (GRCm39) probably null Het
Csmd3 G A 15: 47,701,863 (GRCm39) T1740I probably damaging Het
Dnah7c T G 1: 46,697,450 (GRCm39) S2122A probably benign Het
Enpp2 T C 15: 54,726,027 (GRCm39) N583S probably damaging Het
Fcsk A G 8: 111,610,511 (GRCm39) V964A possibly damaging Het
Gpd2 A T 2: 57,235,367 (GRCm39) I366F probably benign Het
Hsd17b2 G A 8: 118,428,921 (GRCm39) V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 (GRCm39) probably null Het
Idh3b AG AGCACCACAACTG 2: 130,121,593 (GRCm39) probably null Het
Ifi44 A G 3: 151,438,126 (GRCm39) V387A probably benign Het
Kcnc4 T C 3: 107,355,512 (GRCm39) D312G possibly damaging Het
Kif1b T C 4: 149,277,053 (GRCm39) M1337V probably benign Het
Klra6 C T 6: 130,000,682 (GRCm39) V41I probably benign Het
Lrp1 A G 10: 127,393,937 (GRCm39) probably null Het
Mpdz T C 4: 81,301,654 (GRCm39) E257G probably damaging Het
Or10v1 T C 19: 11,873,760 (GRCm39) V125A probably benign Het
Or4f14 T C 2: 111,743,119 (GRCm39) D52G possibly damaging Het
Papln A G 12: 83,828,661 (GRCm39) Y789C probably damaging Het
Pcdh15 T C 10: 74,467,221 (GRCm39) L1680P probably damaging Het
Pcdhac1 A G 18: 37,223,367 (GRCm39) N60S probably benign Het
Polr3g T C 13: 81,826,335 (GRCm39) N162S unknown Het
Pou3f3 A G 1: 42,737,374 (GRCm39) I357V probably damaging Het
Sycp2 A G 2: 177,993,441 (GRCm39) S1235P probably damaging Het
Tns3 A T 11: 8,384,531 (GRCm39) V1429E probably damaging Het
Trim67 T C 8: 125,521,081 (GRCm39) S148P possibly damaging Het
Usp49 A T 17: 47,990,617 (GRCm39) I348F probably damaging Het
Wac A T 18: 7,905,189 (GRCm39) probably null Het
Zfp775 A G 6: 48,596,543 (GRCm39) K139R probably damaging Het
Other mutations in Add1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Add1 APN 5 34,770,702 (GRCm39) missense probably damaging 1.00
IGL01370:Add1 APN 5 34,787,859 (GRCm39) missense probably damaging 1.00
IGL01670:Add1 APN 5 34,777,407 (GRCm39) missense probably damaging 1.00
IGL02965:Add1 APN 5 34,777,467 (GRCm39) missense probably damaging 0.99
IGL03178:Add1 APN 5 34,771,589 (GRCm39) splice site probably null
R0126:Add1 UTSW 5 34,770,923 (GRCm39) missense probably benign 0.04
R0189:Add1 UTSW 5 34,773,992 (GRCm39) missense probably benign 0.01
R0195:Add1 UTSW 5 34,767,990 (GRCm39) unclassified probably benign
R0318:Add1 UTSW 5 34,782,684 (GRCm39) missense probably damaging 0.99
R0605:Add1 UTSW 5 34,771,568 (GRCm39) missense possibly damaging 0.87
R0624:Add1 UTSW 5 34,763,197 (GRCm39) missense probably damaging 1.00
R1514:Add1 UTSW 5 34,767,961 (GRCm39) missense probably benign 0.03
R1573:Add1 UTSW 5 34,758,740 (GRCm39) missense possibly damaging 0.89
R2512:Add1 UTSW 5 34,774,030 (GRCm39) missense probably benign 0.02
R2965:Add1 UTSW 5 34,788,058 (GRCm39) missense probably benign 0.00
R2966:Add1 UTSW 5 34,788,058 (GRCm39) missense probably benign 0.00
R5646:Add1 UTSW 5 34,788,024 (GRCm39) missense probably benign 0.10
R5993:Add1 UTSW 5 34,758,877 (GRCm39) missense probably damaging 1.00
R6356:Add1 UTSW 5 34,776,740 (GRCm39) missense probably null 1.00
R6514:Add1 UTSW 5 34,763,317 (GRCm39) missense probably damaging 1.00
R6659:Add1 UTSW 5 34,770,639 (GRCm39) missense possibly damaging 0.94
R7326:Add1 UTSW 5 34,776,715 (GRCm39) missense probably benign 0.32
R7473:Add1 UTSW 5 34,776,697 (GRCm39) missense possibly damaging 0.84
R8177:Add1 UTSW 5 34,774,049 (GRCm39) missense possibly damaging 0.77
R9084:Add1 UTSW 5 34,763,186 (GRCm39) missense probably damaging 1.00
R9100:Add1 UTSW 5 34,770,622 (GRCm39) unclassified probably benign
R9169:Add1 UTSW 5 34,788,122 (GRCm39) missense possibly damaging 0.94
R9436:Add1 UTSW 5 34,763,273 (GRCm39) nonsense probably null
Z1088:Add1 UTSW 5 34,770,744 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCACTTCTCAGGCTGATGTTC -3'
(R):5'- GTGCTGAGTGATGAGAACTGAC -3'

Sequencing Primer
(F):5'- CTCATAATGAAATCCGAATGGGC -3'
(R):5'- TGACTGTCTTTCAAACAACAGGC -3'
Posted On 2018-06-06