Incidental Mutation 'R6536:Klra6'
ID520411
Institutional Source Beutler Lab
Gene Symbol Klra6
Ensembl Gene ENSMUSG00000061769
Gene Namekiller cell lectin-like receptor, subfamily A, member 6
SynonymsLy49F, Ly49f
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location130013033-130026954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 130023719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 41 (V41I)
Ref Sequence ENSEMBL: ENSMUSP00000073700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074056]
Predicted Effect probably benign
Transcript: ENSMUST00000074056
AA Change: V41I

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000073700
Gene: ENSMUSG00000061769
AA Change: V41I

DomainStartEndE-ValueType
Blast:CLECT 73 123 3e-9 BLAST
CLECT 143 258 8.42e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: This gene belongs to the highly polymorphic family of C-type lectin-like Ly49 genes that are expressed in natural killer (NK) cells. The encoded protein is a homodimeric type II transmembrane receptor located at the cell surface and inhibits NK cell activation upon ligand binding. This gene is located in a cluster of several Klra paralogs on chromosome 6. Different strains of mice show variation in the number of paralogs, including strain specific duplications, deletions and pseudogene sequences. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Klra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Klra6 APN 6 130023700 missense possibly damaging 0.77
IGL02037:Klra6 APN 6 130013476 missense probably benign 0.02
IGL02319:Klra6 APN 6 130025214 missense probably damaging 0.98
IGL02427:Klra6 APN 6 130016717 missense possibly damaging 0.54
IGL02730:Klra6 APN 6 130022697 missense probably benign
IGL02822:Klra6 APN 6 130016710 nonsense probably null
R0485:Klra6 UTSW 6 130023638 missense probably benign 0.12
R0697:Klra6 UTSW 6 130016724 missense probably benign 0.18
R0731:Klra6 UTSW 6 130022705 missense probably damaging 1.00
R1081:Klra6 UTSW 6 130022625 missense probably damaging 0.96
R1708:Klra6 UTSW 6 130022714 nonsense probably null
R1749:Klra6 UTSW 6 130018952 missense probably damaging 1.00
R1842:Klra6 UTSW 6 130022610 missense probably benign 0.14
R1944:Klra6 UTSW 6 130018945 missense possibly damaging 0.92
R4214:Klra6 UTSW 6 130018922 missense probably benign 0.10
R5210:Klra6 UTSW 6 130018892 nonsense probably null
R5286:Klra6 UTSW 6 130018969 missense probably benign 0.02
R5418:Klra6 UTSW 6 130013430 missense probably damaging 0.96
R5764:Klra6 UTSW 6 130022729 missense possibly damaging 0.92
R6193:Klra6 UTSW 6 130018918 missense probably benign 0.12
R6696:Klra6 UTSW 6 130016733 missense probably benign
R7021:Klra6 UTSW 6 130018858 missense possibly damaging 0.93
R7718:Klra6 UTSW 6 130013352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAGAACCATGGACAGTGTG -3'
(R):5'- GCTCATTCTAGGTTGAGTCAAGAG -3'

Sequencing Primer
(F):5'- ACCATGGACAGTGTGTATAGCTGC -3'
(R):5'- TCTAGGTTGAGTCAAGAGGATTAAC -3'
Posted On2018-06-06