Incidental Mutation 'R6536:Hsd17b2'
ID520415
Institutional Source Beutler Lab
Gene Symbol Hsd17b2
Ensembl Gene ENSMUSG00000031844
Gene Namehydroxysteroid (17-beta) dehydrogenase 2
Synonyms17 HSD type 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location117701904-117759027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117702182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 63 (V63M)
Ref Sequence ENSEMBL: ENSMUSP00000034304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034304
AA Change: V63M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034304
Gene: ENSMUSG00000031844
AA Change: V63M

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Pfam:adh_short 84 279 1.3e-48 PFAM
Pfam:KR 85 263 3.6e-7 PFAM
Pfam:DUF1776 85 361 3.2e-13 PFAM
Pfam:adh_short_C2 89 288 1.5e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000212052
AA Change: V32M
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality starting at E11.5 and placenta defects. The few mutants that survive to birth exhibit enlarged brain ventricles, cerebral cortex abnormalities and a single kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Hsd17b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Hsd17b2 APN 8 117758671 missense probably damaging 0.98
IGL00907:Hsd17b2 APN 8 117734694 missense probably benign 0.00
R0664:Hsd17b2 UTSW 8 117758701 missense possibly damaging 0.67
R1506:Hsd17b2 UTSW 8 117702265 critical splice donor site probably null
R1627:Hsd17b2 UTSW 8 117702170 missense possibly damaging 0.53
R1822:Hsd17b2 UTSW 8 117758749 missense possibly damaging 0.47
R1930:Hsd17b2 UTSW 8 117758904 missense possibly damaging 0.56
R2055:Hsd17b2 UTSW 8 117702174 missense possibly damaging 0.96
R3159:Hsd17b2 UTSW 8 117758752 missense probably damaging 1.00
R8074:Hsd17b2 UTSW 8 117758701 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGGAGAATGAGCCCGTTTGC -3'
(R):5'- ATGTGCTGCCTGTCATTCAC -3'

Sequencing Primer
(F):5'- GAATGAGCCCGTTTGCCTCTG -3'
(R):5'- GTGCTGCCTGTCATTCACTCTAAG -3'
Posted On2018-06-06