Mutagenetix > Incidental Mutation

Incidental Mutation 'R6495:Shroom3'

520416

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6495 (G1)

Quality Score

136.008

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92942069 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 893 (Y893H)

Ref Sequence

ENSEMBL: ENSMUSP00000130419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000172706] [ENSMUST00000225438]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000113051
AA Change: Y718H

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381
AA Change: Y718H

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113054
AA Change: Y718H

PolyPhen 2 Score 0.179 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381
AA Change: Y718H

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC
low complexity region	572	586	N/A	INTRINSIC
low complexity region	621	639	N/A	INTRINSIC
low complexity region	685	704	N/A	INTRINSIC
Pfam:ASD1	706	885	2.3e-65	PFAM
low complexity region	939	952	N/A	INTRINSIC
low complexity region	1132	1143	N/A	INTRINSIC
low complexity region	1172	1184	N/A	INTRINSIC
low complexity region	1274	1288	N/A	INTRINSIC
low complexity region	1333	1345	N/A	INTRINSIC
Pfam:ASD2	1478	1765	3.1e-107	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000113055
AA Change: Y893H

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: Y893H

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168878
AA Change: Y893H

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: Y893H

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172706

SMART Domains

Protein: ENSMUSP00000133690
Gene: ENSMUSG00000029381

Domain	Start	End	E-Value	Type
low complexity region	16	27	N/A	INTRINSIC
low complexity region	83	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201800

Predicted Effect

probably benign
Transcript: ENSMUST00000225438
AA Change: Y812H

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak2	T	A	12: 112,773,714	E502V	probably damaging	Het
Apbb1ip	T	A	2: 22,853,120	Y321*	probably null	Het
Apob	A	G	12: 7,990,394	K577R	probably null	Het
Arfgef3	A	G	10: 18,611,202		probably null	Het
Asap3	T	A	4: 136,228,479		probably null	Het
Atp13a5	C	T	16: 29,321,622		probably null	Het
Bcan	C	A	3: 87,996,597	A194S	possibly damaging	Het
Cacybp	T	C	1: 160,208,523	T32A	probably benign	Het
Cd82	A	G	2: 93,430,012	V90A	probably benign	Het
Chd5	C	T	4: 152,367,372	R714C	probably damaging	Het
Cpb2	T	C	14: 75,275,079	Y311H	probably damaging	Het
Cyp39a1	T	C	17: 43,691,694	Y267H	probably benign	Het
Dnajc6	C	T	4: 101,635,065	Q766*	probably null	Het
Dusp3	T	C	11: 101,981,827	I48V	probably benign	Het
Eif3c	A	T	7: 126,547,500	F809I	probably damaging	Het
Exosc10	C	T	4: 148,562,872	P213S	probably benign	Het
Galns	C	T	8: 122,600,610	G141D	probably damaging	Het
Gm3233	A	T	10: 77,759,052		probably benign	Het
Hadha	A	T	5: 30,120,050	L714H	probably benign	Het
Map3k20	T	C	2: 72,368,419	M123T	probably damaging	Het
Nt5dc1	A	G	10: 34,324,369	L217P	probably damaging	Het
Nubp2	A	T	17: 24,885,603	D54E	probably damaging	Het
Olfr1471	T	A	19: 13,445,625	D204E	probably benign	Het
Onecut1	C	T	9: 74,863,215	R307C	probably damaging	Het
Pcdhb17	A	G	18: 37,485,667	Y170C	probably damaging	Het
Pkd2	T	A	5: 104,489,293	C591S	probably damaging	Het
Pramef20	T	C	4: 144,376,839	N239S	probably benign	Het
Pwp2	A	T	10: 78,177,127	V549E	probably damaging	Het
Rapsn	A	T	2: 91,036,628	S92C	probably damaging	Het
Rbm19	A	G	5: 120,119,680	S90G	probably damaging	Het
Rfc1	G	A	5: 65,273,815		probably null	Het
Rims2	T	A	15: 39,517,812	F1046L	probably benign	Het
S100a16	C	T	3: 90,542,428	R73C	probably benign	Het
Stt3b	T	A	9: 115,267,320	Y253F	possibly damaging	Het
Taar8b	A	G	10: 24,091,262	*345Q	probably null	Het
Tas2r119	G	A	15: 32,177,530	V81I	probably benign	Het
Tas2r129	A	G	6: 132,951,165	I22V	probably benign	Het
Tbc1d19	T	G	5: 53,889,213		probably null	Het
Tnip3	A	T	6: 65,605,862	I218F	probably benign	Het
Tnks	A	T	8: 34,839,966		probably null	Het
Ttc29	T	C	8: 78,282,334	Y278H	possibly damaging	Het
Uba7	T	A	9: 107,977,014	C214*	probably null	Het
Vmn2r115	A	T	17: 23,359,598	I682F	probably benign	Het
Vmn2r75	A	T	7: 86,164,079	M505K	probably benign	Het
Wdr19	A	T	5: 65,258,123	T1313S	probably benign	Het
Zbtb22	A	G	17: 33,917,250	D123G	probably damaging	Het
Zcchc6	T	C	13: 59,799,939	E454G	possibly damaging	Het
Zdhhc7	A	G	8: 120,086,656	I138T	probably benign	Het
Zfp706	T	C	15: 37,003,801	K7R	unknown	Het
Zkscan3	G	A	13: 21,387,905	P519L	probably damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7728:Shroom3	UTSW	5	92683707	missense	possibly damaging	0.73
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CACTGAACACCTGCGCAATG -3'
(R):5'- TAGGAGCGCTTCTTCTGCTC -3'

Sequencing Primer
(F):5'- ACACCTGCGCAATGGGGAG -3'
(R):5'- GTCACGCTGTGTCGCTC -3'

Posted On

2018-06-06