Incidental Mutation 'R6536:Trim67'
ID520417
Institutional Source Beutler Lab
Gene Symbol Trim67
Ensembl Gene ENSMUSG00000036913
Gene Nametripartite motif-containing 67
SynonymsD130049O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R6536 (G1)
Quality Score167.009
Status Validated
Chromosome8
Chromosomal Location124793092-124834713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124794342 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 148 (S148P)
Ref Sequence ENSEMBL: ENSMUSP00000148625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041106] [ENSMUST00000167588] [ENSMUST00000211867]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041106
AA Change: S148P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040601
Gene: ENSMUSG00000036913
AA Change: S148P

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 635 755 1.3e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167588
AA Change: S148P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130343
Gene: ENSMUSG00000036913
AA Change: S148P

DomainStartEndE-ValueType
RING 7 157 1.41e-4 SMART
BBOX 198 248 4.65e-5 SMART
BBOX 285 327 3.04e-9 SMART
BBC 334 460 1.18e-28 SMART
FN3 498 579 1.75e-6 SMART
Pfam:SPRY 633 756 3.6e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000211867
AA Change: S148P

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Trim67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Trim67 APN 8 124815060 splice site probably benign
IGL01676:Trim67 APN 8 124815160 missense possibly damaging 0.51
IGL01779:Trim67 APN 8 124828121 missense probably damaging 1.00
IGL02057:Trim67 APN 8 124823130 missense probably benign 0.00
IGL02201:Trim67 APN 8 124794058 missense probably benign 0.26
IGL02304:Trim67 APN 8 124825952 missense probably damaging 1.00
R0068:Trim67 UTSW 8 124794568 missense probably damaging 0.97
R0241:Trim67 UTSW 8 124823190 missense probably damaging 0.99
R0319:Trim67 UTSW 8 124823227 missense probably damaging 0.98
R0471:Trim67 UTSW 8 124794658 missense probably benign 0.01
R1171:Trim67 UTSW 8 124829081 missense probably damaging 0.97
R1175:Trim67 UTSW 8 124817035 missense probably damaging 0.99
R1444:Trim67 UTSW 8 124823193 missense probably benign 0.01
R1596:Trim67 UTSW 8 124826139 missense probably damaging 0.97
R1706:Trim67 UTSW 8 124794421 missense probably damaging 1.00
R4951:Trim67 UTSW 8 124794667 missense probably benign
R5200:Trim67 UTSW 8 124824850 missense probably damaging 0.99
R5787:Trim67 UTSW 8 124794312 nonsense probably null
R6023:Trim67 UTSW 8 124815104 missense probably damaging 0.99
R6290:Trim67 UTSW 8 124823179 missense probably benign 0.00
R7315:Trim67 UTSW 8 124794330 missense probably benign 0.18
R7660:Trim67 UTSW 8 124820285 missense probably damaging 1.00
R8432:Trim67 UTSW 8 124794062 small deletion probably benign
R8446:Trim67 UTSW 8 124793991 missense probably damaging 0.99
R8713:Trim67 UTSW 8 124820335 missense probably null 0.06
Z1088:Trim67 UTSW 8 124817041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACAATGTCTGCTTGCCGTG -3'
(R):5'- TAGAGCACGTCGCATTGCTC -3'

Sequencing Primer
(F):5'- ACTATCGCGGTTCAGACCC -3'
(R):5'- CAGAGAGTGGCTGCCGG -3'
Posted On2018-06-06