Incidental Mutation 'R6536:Tdgf1'
ID520419
Institutional Source Beutler Lab
Gene Symbol Tdgf1
Ensembl Gene ENSMUSG00000032494
Gene Nameteratocarcinoma-derived growth factor 1
SynonymsCR1, cripto
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110939603-110946158 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 110944189 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035075] [ENSMUST00000197460] [ENSMUST00000199196] [ENSMUST00000199782]
Predicted Effect probably null
Transcript: ENSMUST00000035075
SMART Domains Protein: ENSMUSP00000035075
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 65 91 1.8e1 SMART
Pfam:CFC 99 133 2.7e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197460
SMART Domains Protein: ENSMUSP00000143394
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199196
SMART Domains Protein: ENSMUSP00000142397
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199782
SMART Domains Protein: ENSMUSP00000143669
Gene: ENSMUSG00000032494

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 31 57 8.9e-2 SMART
Pfam:CFC 65 90 1.4e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an epidermal growth factor-related protein that contains a cripto, FRL-1, and cryptic domain. The encoded protein is an extracellular, membrane-bound signaling protein that plays an essential role in embryonic development and tumor growth. Mutations in this gene are associated with forebrain defects. Pseudogenes of this gene are found on chromosomes 2, 3, 6, 8, 19 and X. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in rostral-caudal axis formation, embryonic development and heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Polr3g T C 13: 81,678,216 N162S unknown Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Tdgf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Tdgf1 APN 9 110942623 missense probably damaging 1.00
IGL03037:Tdgf1 APN 9 110943220 missense probably benign 0.23
R1171:Tdgf1 UTSW 9 110943167 missense probably benign 0.37
R3792:Tdgf1 UTSW 9 110943190 missense probably benign 0.02
R4012:Tdgf1 UTSW 9 110940713 missense probably benign
R5488:Tdgf1 UTSW 9 110943197 missense probably benign 0.01
R5955:Tdgf1 UTSW 9 110944213 missense unknown
R7624:Tdgf1 UTSW 9 110945949 start gained probably benign
R8206:Tdgf1 UTSW 9 110944284 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGACTTGGTGACATCCAGTTTC -3'
(R):5'- TAAGAGAGGGAACTTCTGTCCG -3'

Sequencing Primer
(F):5'- GGTGACATCCAGTTTCAAAAACCTG -3'
(R):5'- GAACTTCTGTCCGGTTTTGTTAC -3'
Posted On2018-06-06