Incidental Mutation 'R6495:Tas2r129'
ID520424
Institutional Source Beutler Lab
Gene Symbol Tas2r129
Ensembl Gene ENSMUSG00000063762
Gene Nametaste receptor, type 2, member 129
SynonymsTas2r29, mt2r60, T2R29, mGR29
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132951102-132952066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132951165 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 22 (I22V)
Ref Sequence ENSEMBL: ENSMUSP00000067640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070991]
Predicted Effect probably benign
Transcript: ENSMUST00000070991
AA Change: I22V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000067640
Gene: ENSMUSG00000063762
AA Change: I22V

DomainStartEndE-ValueType
Pfam:TAS2R 1 302 2.3e-74 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Eif3c A T 7: 126,547,500 F809I probably damaging Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Tas2r129
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Tas2r129 APN 6 132951394 nonsense probably null
R0389:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0443:Tas2r129 UTSW 6 132951196 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951943 missense probably benign 0.26
R0487:Tas2r129 UTSW 6 132951944 missense probably benign 0.31
R0576:Tas2r129 UTSW 6 132951534 missense probably benign 0.38
R1253:Tas2r129 UTSW 6 132952036 missense probably benign 0.11
R3124:Tas2r129 UTSW 6 132951448 missense probably damaging 1.00
R4493:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4494:Tas2r129 UTSW 6 132951354 missense probably benign 0.31
R4591:Tas2r129 UTSW 6 132951611 missense probably benign 0.10
R6156:Tas2r129 UTSW 6 132951492 missense probably benign 0.31
R7600:Tas2r129 UTSW 6 132951174 nonsense probably null
R7608:Tas2r129 UTSW 6 132951193 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCAAATATTCTCCACACCACTTGG -3'
(R):5'- CTTCTAGTTACCAACACGTGTG -3'

Sequencing Primer
(F):5'- TCGCTCTCACAGAAAAAGAGATATG -3'
(R):5'- GTGTATAGCGTAGACACTGCTATAAC -3'
Posted On2018-06-06