Incidental Mutation 'R6495:Eif3c'
ID520428
Institutional Source Beutler Lab
Gene Symbol Eif3c
Ensembl Gene ENSMUSG00000030738
Gene Nameeukaryotic translation initiation factor 3, subunit C
SynonymsNIPIL(A3), 3230401O13Rik, 110kDa, Xs, Eif3s8, Xsl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6495 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126546455-126566411 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126547500 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 809 (F809I)
Ref Sequence ENSEMBL: ENSMUSP00000032992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032992]
Predicted Effect probably damaging
Transcript: ENSMUST00000032992
AA Change: F809I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032992
Gene: ENSMUSG00000030738
AA Change: F809I

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Pfam:eIF-3c_N 29 703 9.6e-267 PFAM
PINT 776 864 9.7e-27 SMART
Meta Mutation Damage Score 0.8792 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Mutations in this gene result in a range of abnormal limb development, including polydactyly, and white coat spotting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,773,714 E502V probably damaging Het
Apbb1ip T A 2: 22,853,120 Y321* probably null Het
Apob A G 12: 7,990,394 K577R probably null Het
Arfgef3 A G 10: 18,611,202 probably null Het
Asap3 T A 4: 136,228,479 probably null Het
Atp13a5 C T 16: 29,321,622 probably null Het
Bcan C A 3: 87,996,597 A194S possibly damaging Het
Cacybp T C 1: 160,208,523 T32A probably benign Het
Cd82 A G 2: 93,430,012 V90A probably benign Het
Chd5 C T 4: 152,367,372 R714C probably damaging Het
Cpb2 T C 14: 75,275,079 Y311H probably damaging Het
Cyp39a1 T C 17: 43,691,694 Y267H probably benign Het
Dnajc6 C T 4: 101,635,065 Q766* probably null Het
Dusp3 T C 11: 101,981,827 I48V probably benign Het
Exosc10 C T 4: 148,562,872 P213S probably benign Het
Galns C T 8: 122,600,610 G141D probably damaging Het
Gm3233 A T 10: 77,759,052 probably benign Het
Hadha A T 5: 30,120,050 L714H probably benign Het
Map3k20 T C 2: 72,368,419 M123T probably damaging Het
Nt5dc1 A G 10: 34,324,369 L217P probably damaging Het
Nubp2 A T 17: 24,885,603 D54E probably damaging Het
Olfr1471 T A 19: 13,445,625 D204E probably benign Het
Onecut1 C T 9: 74,863,215 R307C probably damaging Het
Pcdhb17 A G 18: 37,485,667 Y170C probably damaging Het
Pkd2 T A 5: 104,489,293 C591S probably damaging Het
Pramef20 T C 4: 144,376,839 N239S probably benign Het
Pwp2 A T 10: 78,177,127 V549E probably damaging Het
Rapsn A T 2: 91,036,628 S92C probably damaging Het
Rbm19 A G 5: 120,119,680 S90G probably damaging Het
Rfc1 G A 5: 65,273,815 probably null Het
Rims2 T A 15: 39,517,812 F1046L probably benign Het
S100a16 C T 3: 90,542,428 R73C probably benign Het
Shroom3 T C 5: 92,942,069 Y893H possibly damaging Het
Stt3b T A 9: 115,267,320 Y253F possibly damaging Het
Taar8b A G 10: 24,091,262 *345Q probably null Het
Tas2r119 G A 15: 32,177,530 V81I probably benign Het
Tas2r129 A G 6: 132,951,165 I22V probably benign Het
Tbc1d19 T G 5: 53,889,213 probably null Het
Tnip3 A T 6: 65,605,862 I218F probably benign Het
Tnks A T 8: 34,839,966 probably null Het
Ttc29 T C 8: 78,282,334 Y278H possibly damaging Het
Uba7 T A 9: 107,977,014 C214* probably null Het
Vmn2r115 A T 17: 23,359,598 I682F probably benign Het
Vmn2r75 A T 7: 86,164,079 M505K probably benign Het
Wdr19 A T 5: 65,258,123 T1313S probably benign Het
Zbtb22 A G 17: 33,917,250 D123G probably damaging Het
Zcchc6 T C 13: 59,799,939 E454G possibly damaging Het
Zdhhc7 A G 8: 120,086,656 I138T probably benign Het
Zfp706 T C 15: 37,003,801 K7R unknown Het
Zkscan3 G A 13: 21,387,905 P519L probably damaging Het
Other mutations in Eif3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Eif3c APN 7 126559008 missense probably benign
IGL01380:Eif3c APN 7 126564413 intron probably benign
IGL01434:Eif3c APN 7 126556410 missense probably damaging 0.99
IGL01534:Eif3c APN 7 126557695 missense probably benign 0.07
IGL02493:Eif3c APN 7 126558901 missense probably damaging 0.98
IGL02544:Eif3c APN 7 126547612 nonsense probably null
IGL02821:Eif3c APN 7 126558659 missense probably benign
IGL02963:Eif3c APN 7 126556820 missense probably benign 0.00
R0194:Eif3c UTSW 7 126558623 unclassified probably benign
R0421:Eif3c UTSW 7 126563712 missense possibly damaging 0.95
R1486:Eif3c UTSW 7 126564721 missense probably damaging 1.00
R2378:Eif3c UTSW 7 126552325 missense probably damaging 0.99
R4135:Eif3c UTSW 7 126566299 unclassified probably benign
R4223:Eif3c UTSW 7 126566299 unclassified probably benign
R4225:Eif3c UTSW 7 126566299 unclassified probably benign
R4898:Eif3c UTSW 7 126557454 missense probably benign 0.03
R5144:Eif3c UTSW 7 126563066 missense probably benign
R5246:Eif3c UTSW 7 126557238 missense possibly damaging 0.66
R5845:Eif3c UTSW 7 126564755 missense probably damaging 0.99
R6884:Eif3c UTSW 7 126556879 missense probably benign 0.01
R7236:Eif3c UTSW 7 126552323 missense possibly damaging 0.63
R7691:Eif3c UTSW 7 126551990 missense possibly damaging 0.95
R7744:Eif3c UTSW 7 126558894 missense probably damaging 1.00
X0065:Eif3c UTSW 7 126552085 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATCACCACAGTCTGTGTC -3'
(R):5'- ACAATCTGCCAGGCTCCTTC -3'

Sequencing Primer
(F):5'- ACCACAGTCTGTGTCGGCTG -3'
(R):5'- GCCAGGCTCCTTCCTTTAGG -3'
Posted On2018-06-06