Incidental Mutation 'R6536:Polr3g'
ID520431
Institutional Source Beutler Lab
Gene Symbol Polr3g
Ensembl Gene ENSMUSG00000035834
Gene Namepolymerase (RNA) III (DNA directed) polypeptide G
SynonymsRPC32, 2310047G20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6536 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location81673843-81711013 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81678216 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 162 (N162S)
Ref Sequence ENSEMBL: ENSMUSP00000035289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048993]
Predicted Effect unknown
Transcript: ENSMUST00000048993
AA Change: N162S
SMART Domains Protein: ENSMUSP00000035289
Gene: ENSMUSG00000035834
AA Change: N162S

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 223 7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162535
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (36/36)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik2 G T 11: 49,019,723 H628N probably benign Het
Abcb1a T A 5: 8,719,030 F751I probably benign Het
Adamts13 G A 2: 26,975,750 V106M probably damaging Het
Add1 C A 5: 34,601,436 N31K possibly damaging Het
Adgrf5 G T 17: 43,422,661 probably benign Het
Akap11 T G 14: 78,511,314 D1211A possibly damaging Het
Atp5c1 G A 2: 10,080,316 probably benign Het
Cd320 T C 17: 33,847,503 S72P probably benign Het
Clca4b C A 3: 144,916,729 W525L possibly damaging Het
Csmd3 G A 15: 47,838,467 T1740I probably damaging Het
Dnah7c T G 1: 46,658,290 S2122A probably benign Het
Enpp2 T C 15: 54,862,631 N583S probably damaging Het
Fuk A G 8: 110,883,879 V964A possibly damaging Het
Gpd2 A T 2: 57,345,355 I366F probably benign Het
Hsd17b2 G A 8: 117,702,182 V63M possibly damaging Het
Hsdl2 A T 4: 59,610,508 probably null Het
Idh3b AG AGCACCACAACTG 2: 130,279,673 probably null Het
Ifi44 A G 3: 151,732,489 V387A probably benign Het
Kcnc4 T C 3: 107,448,196 D312G possibly damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Klra6 C T 6: 130,023,719 V41I probably benign Het
Lrp1 A G 10: 127,558,068 probably null Het
Mpdz T C 4: 81,383,417 E257G probably damaging Het
Olfr1306 T C 2: 111,912,774 D52G possibly damaging Het
Olfr1420 T C 19: 11,896,396 V125A probably benign Het
Papln A G 12: 83,781,887 Y789C probably damaging Het
Pcdh15 T C 10: 74,631,389 L1680P probably damaging Het
Pcdhac1 A G 18: 37,090,314 N60S probably benign Het
Pou3f3 A G 1: 42,698,214 I357V probably damaging Het
Sycp2 A G 2: 178,351,648 S1235P probably damaging Het
Tdgf1 A T 9: 110,944,189 probably null Het
Tns3 A T 11: 8,434,531 V1429E probably damaging Het
Trim67 T C 8: 124,794,342 S148P possibly damaging Het
Usp49 A T 17: 47,679,692 I348F probably damaging Het
Wac A T 18: 7,905,189 probably null Het
Zfp775 A G 6: 48,619,609 K139R probably damaging Het
Other mutations in Polr3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Polr3g APN 13 81694677 missense probably damaging 1.00
IGL01764:Polr3g APN 13 81682119 missense possibly damaging 0.93
R0118:Polr3g UTSW 13 81676121 unclassified probably benign
R0550:Polr3g UTSW 13 81694773 missense probably damaging 0.99
R3725:Polr3g UTSW 13 81694635 missense probably damaging 0.99
R6684:Polr3g UTSW 13 81699531 splice site probably null
R7645:Polr3g UTSW 13 81694444 missense unknown
R8296:Polr3g UTSW 13 81694563 missense unknown
R8317:Polr3g UTSW 13 81678183 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCACTGTACTCGTTAACGTGAAG -3'
(R):5'- GGCTGGTAATCCCGTAATTTAGG -3'

Sequencing Primer
(F):5'- CGTGAAGTATTTATCAACTCAACTCC -3'
(R):5'- CCCGTAATTTAGGATTCAGCGAG -3'
Posted On2018-06-06